Order Kazusa clone(s) from : ![]() |
Product ID | ORK04514 |
---|---|
Accession No | AB053445 |
Description | cadherin-related 23 |
Clone name | hk10268 |
Vector information | |
cDNA sequence | DNA sequence (4256 bp) Predicted protein sequence (1041 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1078 bp |
---|---|
Genome contig ID | gi89161187f_73126672 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (118989 - 119038) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 73226619 | 73245659 | 21 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 274 | 293 | PR00205 | Cadherin |
IPR002126 | 337 | 366 | PR00205 | Cadherin | |
IPR002126 | 404 | 416 | PR00205 | Cadherin | |
IPR002126 | 418 | 437 | PR00205 | Cadherin | |
IPR002126 | 497 | 523 | PR00205 | Cadherin | |
IPR002126 | 532 | 549 | PR00205 | Cadherin | |
HMMPfam | IPR002126 | 129 | 221 | PF00028 | Cadherin |
IPR002126 | 235 | 328 | PF00028 | Cadherin | |
IPR002126 | 342 | 430 | PF00028 | Cadherin | |
IPR002126 | 446 | 534 | PF00028 | Cadherin | |
IPR002126 | 561 | 643 | PF00028 | Cadherin | |
IPR002126 | 679 | 714 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 24 | 119 | SM00112 | Cadherin |
IPR002126 | 146 | 228 | SM00112 | Cadherin | |
IPR002126 | 252 | 335 | SM00112 | Cadherin | |
IPR002126 | 359 | 437 | SM00112 | Cadherin | |
IPR002126 | 463 | 548 | SM00112 | Cadherin | |
IPR002126 | 579 | 672 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 65 | 121 | PS50268 | Cadherin |
IPR002126 | 125 | 230 | PS50268 | Cadherin | |
IPR002126 | 231 | 337 | PS50268 | Cadherin | |
IPR002126 | 338 | 439 | PS50268 | Cadherin | |
IPR002126 | 442 | 550 | PS50268 | Cadherin | |
IPR002126 | 557 | 674 | PS50268 | Cadherin | |
IPR002126 | 675 | 803 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 109 | 119 | PS00232 | Cadherin |
IPR002126 | 218 | 228 | PS00232 | Cadherin | |
IPR002126 | 427 | 437 | PS00232 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 893 | LQMAIIVLAILLFLAAMLFVLMN | 915 | PRIMARY | 23 |
![]() |
Primer_f | CCAAGTCTCGCTACATTTCCG |
---|---|
Primer_r | GTGAAATGGAGAGAATGCTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCAAGTCTCGCTACATTTCCG |
Primer_r | GTGAAATGGAGAGAATGCTTG |
PCR product length | 115 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |