KIAA1706

Product ID	ORK00892
Accession No	AB051493
Description	endonuclease/exonuclease/phosphatase family domain containing 1
Clone name	fj17179
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4427 bp) Predicted protein sequence (573 aa)
HaloTag ORF Clone	FHC00892
Flexi ORF Clone	FXC00892
Source	Human fetal brain
Rouge ID	mKIAA1706 by Kazusa Mouse cDNA Project

Length: 4427 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2336 bp
Genome contig ID	gi89161213f_36059620
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- TTATATTAAAGTTCACTCTTTGTGTTGTGCATCCT
Flanking genome sequence (248058 - 248107)	----+--------+--------+--------+--------+----* ATGGGTTTTGACAAATGTAGAATGACATGTATCACCATGCTACAGAATCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	36159620	36307676	8	99.4	Perfect prediction

Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_085139	0	99.8	endonuclease/ex...	Homo sapiens
XP_001103689	0	98.4	hypothetical pr...	Macaca mulatta
XP_001501241	0	94.0	similar to endo...	Equus caballus
Q3MHJ7	0	93.2	Endonuclease/ex...	Bos taurus
Q5XI74	1e-216	91.0	Endonuclease/ex...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000445	42	71	PF00633	Helix-hairpin-helix motif
HMMPfam	IPR005135	265	542	PF03372	Endonuclease/exonuclease/phosphatase
HMMSmart	IPR003583	52	71	SM00278	Helix-hairpin-helix DNA-binding
	IPR003583	82	101	SM00278	Helix-hairpin-helix DNA-binding
	IPR003583	149	168	SM00278	Helix-hairpin-helix DNA-binding
HMMTigr	IPR004509	42	104	TIGR00426	Competence protein ComEA helix-hairpin-helix region

Primer_f	ACCCTTGTTAACCTTCACCTG
Primer_r	TCATAGTCATTGCTGTCTGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-