Order Kazusa clone(s) from : ![]() |
Product ID | ORK05700 |
---|---|
Accession No | AB051465 |
Description | SPHK1 interactor, AKAP domain containing |
Clone name | fh20705 |
Vector information | |
cDNA sequence | DNA sequence (5670 bp) Predicted protein sequence (1302 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1678
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1759 bp |
---|---|
Genome contig ID | gi89161199r_228452918 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 228552918 | 228592708 | 5 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CCTGACTCGTAGATATTAGCC |
---|---|
Primer_r | CCGTGTAGGTCATTTAGTTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |