Order Kazusa clone(s) from : ![]() |
Product ID | ORK05416 |
---|---|
Accession No | AB046813 |
Description | HECT and RLD domain containing E3 ubiquitin protein ligase 4 |
Clone name | fj09260 |
Vector information | |
cDNA sequence | DNA sequence (4362 bp) Predicted protein sequence (953 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1593
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1023 bp |
---|---|
Genome contig ID | gi89161187r_69251671 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 69351671 | 69469730 | 23 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000408 | 38 | 54 | PR00633 | Regulator of chromosome condensation |
IPR000408 | 54 | 68 | PR00633 | Regulator of chromosome condensation | |
IPR000408 | 146 | 164 | PR00633 | Regulator of chromosome condensation | |
IPR000408 | 205 | 226 | PR00633 | Regulator of chromosome condensation | |
HMMPfam | IPR000408 | 53 | 101 | PF00415 | Regulator of chromosome condensation |
IPR000408 | 104 | 153 | PF00415 | Regulator of chromosome condensation | |
IPR000569 | 655 | 953 | PF00632 | HECT | |
HMMSmart | IPR000569 | 624 | 953 | SM00119 | HECT |
ProfileScan | IPR000408 | 52 | 104 | PS50012 | Regulator of chromosome condensation |
IPR000408 | 105 | 156 | PS50012 | Regulator of chromosome condensation | |
IPR000408 | 157 | 208 | PS50012 | Regulator of chromosome condensation | |
IPR000408 | 210 | 276 | PS50012 | Regulator of chromosome condensation | |
IPR000569 | 626 | 953 | PS50237 | HECT | |
ScanRegExp | IPR000408 | 38 | 48 | PS00626 | Regulator of chromosome condensation |
IPR000408 | 143 | 153 | PS00626 | Regulator of chromosome condensation |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | SCFPKIMCVDSLVRICSGLSYGR | 23 | SECONDARY | 23 | 2 | 690 | LFHLIGVICGLAIYNCTIVDLHF | 712 | PRIMARY | 23 |
---|
![]() |
Primer_f | AACAGCAGGCCTATGGAATGG |
---|---|
Primer_r | ATAGCCATCTGCATCTGTAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |