Order Kazusa clone(s) from : ![]() |
Product ID | ORK00183 |
---|---|
Accession No | AB032958 |
Description | Down syndrome cell adhesion molecule like 1 |
Clone name | hh01132s1 |
Vector information | |
cDNA sequence | DNA sequence (6834 bp) Predicted protein sequence (2092 aa) |
HaloTag ORF Clone |
FHC00183
![]() |
Flexi ORF Clone | FXC00183 |
Source | Human adult brain |
Rouge ID |
mKIAA1132
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01132, former representative clones for KIAA1132 with hh01132s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 555 bp |
---|---|
Genome contig ID | gi51511727r_116703699 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 116803699 | 117173121 | 33 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013098 | 265 | 350 | PF07679 | Immunoglobulin I-set |
IPR013151 | 368 | 427 | PF00047 | Immunoglobulin | |
IPR013098 | 447 | 541 | PF07679 | Immunoglobulin I-set | |
IPR013151 | 558 | 616 | PF00047 | Immunoglobulin | |
IPR013151 | 649 | 710 | PF00047 | Immunoglobulin | |
IPR013098 | 729 | 824 | PF07679 | Immunoglobulin I-set | |
IPR013151 | 842 | 908 | PF00047 | Immunoglobulin | |
IPR003961 | 926 | 1013 | PF00041 | Fibronectin | |
IPR003961 | 1025 | 1117 | PF00041 | Fibronectin | |
IPR003961 | 1129 | 1218 | PF00041 | Fibronectin | |
IPR003961 | 1230 | 1316 | PF00041 | Fibronectin | |
IPR013098 | 1329 | 1419 | PF07679 | Immunoglobulin I-set | |
IPR003961 | 1423 | 1506 | PF00041 | Fibronectin | |
IPR003961 | 1520 | 1602 | PF00041 | Fibronectin | |
HMMSmart | IPR003599 | 71 | 161 | SM00409 | Immunoglobulin subtype |
IPR003598 | 77 | 149 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 170 | 258 | SM00409 | Immunoglobulin subtype | |
IPR003599 | 271 | 351 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 277 | 340 | SM00408 | Immunoglobulin subtype 2 | |
IPR003596 | 281 | 335 | SM00406 | Immunoglobulin V-set | |
IPR003599 | 360 | 442 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 366 | 432 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 453 | 542 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 459 | 531 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 550 | 633 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 556 | 621 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 641 | 726 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 647 | 715 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 735 | 825 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 741 | 813 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 834 | 924 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 840 | 913 | SM00408 | Immunoglobulin subtype 2 | |
IPR003961 | 926 | 1010 | SM00060 | Fibronectin | |
IPR003961 | 1026 | 1114 | SM00060 | Fibronectin | |
IPR003961 | 1129 | 1215 | SM00060 | Fibronectin | |
IPR003961 | 1230 | 1313 | SM00060 | Fibronectin | |
IPR003599 | 1338 | 1420 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1344 | 1409 | SM00408 | Immunoglobulin subtype 2 | |
IPR003596 | 1345 | 1404 | SM00406 | Immunoglobulin V-set | |
IPR003961 | 1423 | 1503 | SM00060 | Fibronectin | |
IPR003961 | 1518 | 1599 | SM00060 | Fibronectin | |
ProfileScan | IPR007110 | 57 | 146 | PS50835 | Immunoglobulin-like |
IPR007110 | 154 | 256 | PS50835 | Immunoglobulin-like | |
IPR007110 | 265 | 345 | PS50835 | Immunoglobulin-like | |
IPR007110 | 353 | 441 | PS50835 | Immunoglobulin-like | |
IPR007110 | 447 | 540 | PS50835 | Immunoglobulin-like | |
IPR007110 | 545 | 625 | PS50835 | Immunoglobulin-like | |
IPR007110 | 635 | 724 | PS50835 | Immunoglobulin-like | |
IPR007110 | 729 | 823 | PS50835 | Immunoglobulin-like | |
IPR007110 | 827 | 924 | PS50835 | Immunoglobulin-like | |
IPR003961 | 926 | 1019 | PS50853 | Fibronectin | |
IPR003961 | 1025 | 1124 | PS50853 | Fibronectin | |
IPR003961 | 1129 | 1225 | PS50853 | Fibronectin | |
IPR003961 | 1230 | 1322 | PS50853 | Fibronectin | |
IPR007110 | 1317 | 1416 | PS50835 | Immunoglobulin-like | |
IPR003961 | 1419 | 1513 | PS50853 | Fibronectin | |
IPR003961 | 1518 | 1608 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 34 | IGPLYGMWLVTFLLLLDSLHK | 54 | SECONDARY | 21 | 2 | 1631 | LFTIGCPVILATLGVALLFIV | 1651 | PRIMARY | 21 |
---|
![]() |
Primer_f | CCAAAATCCCAACTCAGAGAC |
---|---|
Primer_r | AACCTTTATTGCACACGGCGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCAAGAAGTTCGCCCAGTATG |
Primer_r | TTGAGGACGCCATTGAGGGTG |
PCR product length | 205(3.0k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |