KIAA1565

Product ID	ORK06152
Accession No	AB046785
Description	ninein (GSK3B interacting protein)
Clone name	bf00184
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8145 bp) Predicted protein sequence (1313 aa)
HaloTag ORF Clone	FHC06152
Flexi ORF Clone	FXC06152
Source	Human adult brain
Rouge ID	mKIAA1565 by Kazusa Mouse cDNA Project
Note	We replaced fh21392, former representative clones for KIAA1565 with bf00184. (2002/5/10)

Length: 8145 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	4201 bp
Genome contig ID	gi51511730r_50156222
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- TTAATAAAGTTTCAGTGTATTTATCATTGGTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAATGGTAGCATCAAAATATTTCACTAAACACATTCTACAAATGCAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	50256222	50367514	31	99.5	Perfect prediction

Length: 1313 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65701	100.0	ninein (GSK3B i...	Homo sapiens
AAH90932	99.9	NIN protein [Ho...	Homo sapiens
XP_001098065	61.8	similar to nine...	Macaca mulatta
NP_891989	63.6	ninein isoform ...	Homo sapiens
Q8N4C6	63.6	Ninein; hNinein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023197	9.7e-27	30.2	KIAA0980
AB046781	3.5e-06	22.3	KIAA1561
AB051536	6e-05	22.0	KIAA1749
AB046821	7.4e-05	22.3	KIAA1601
AB033102	9.3e-05	22.1	KIAA1276

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002048	50	78	PF00036	Calcium-binding EF-hand
ProfileScan	IPR002048	46	81	PS50222	Calcium-binding EF-hand
	IPR002048	98	115	PS50222	Calcium-binding EF-hand
	IPR002048	220	255	PS50222	Calcium-binding EF-hand
	IPR002048	257	290	PS50222	Calcium-binding EF-hand
	IPR002048	355	390	PS50222	Calcium-binding EF-hand

Primer_f	TCATTTGGGGAGCTGGTCTTC
Primer_r	GAGAGACAGAAAACCTACATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-