KIAA1506

Product ID	ORK06006
Accession No	AB040939
Description	lysine (K)-specific methyltransferase 2C
Clone name	ff04330
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9929 bp) Predicted protein sequence (3309 aa)
Source	Human fetal brain
Rouge ID	mKIAA1506 by Kazusa Mouse cDNA Project
Note	We replaced hk04442, former representative clones for KIAA1506 with ff04330. (2002/5/10)

Length: 9929 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161213r_151386957
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCAGAGGACGGGTGAGAAAGCAGCACCTCGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAAAAGGAAAAAGGACGAAGAGGAGAAACAAGCTATGTACTCTAGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	151486957	151578940	33	99.8	Perfect prediction

Length: 3309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51838	100.0	MLL3 protein [H...	Homo sapiens
Q8NEZ4	100.0	Histone-lysine ...	Homo sapiens
EAW53972	100.0	hCG1990594, iso...	Homo sapiens
EAW53971	100.0	hCG1990594, iso...	Homo sapiens
AAK00583	99.8	MLL3 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	404	455	PF00628	Zinc finger
	IPR001965	456	502	PF00628	Zinc finger
	IPR001965	531	584	PF00628	Zinc finger
	IPR000910	1100	1153	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR001965	404	453	SM00249	Zinc finger
	IPR001965	454	500	SM00249	Zinc finger
	IPR001965	531	582	SM00249	Zinc finger
	IPR000910	1094	1158	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR001965	402	455	PS50016	Zinc finger
	IPR001965	452	502	PS50016	Zinc finger
	IPR001965	529	584	PS50016	Zinc finger
ScanRegExp	IPR001965	405	473	PS01359	Zinc finger
ScanRegExp	IPR000194	851	860	PS00152	ATPase

Primer_f	GCCCTCCTTCATTTGTTCCTG
Primer_r	CTGGAGGTGCTGCTGGTAAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-