Order Kazusa clone(s) from : ![]() |
Product ID | ORK06006 |
---|---|
Accession No | AB040939 |
Description | lysine (K)-specific methyltransferase 2C |
Clone name | ff04330 |
Vector information | |
cDNA sequence | DNA sequence (9929 bp) Predicted protein sequence (3309 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1506
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04442, former representative clones for KIAA1506 with ff04330. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 0 bp |
---|---|
Genome contig ID | gi89161213r_151386957 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 151486957 | 151578940 | 33 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 404 | 455 | PF00628 | Zinc finger |
IPR001965 | 456 | 502 | PF00628 | Zinc finger | |
IPR001965 | 531 | 584 | PF00628 | Zinc finger | |
IPR000910 | 1100 | 1153 | PF00505 | HMG1/2 (high mobility group) box | |
HMMSmart | IPR001965 | 404 | 453 | SM00249 | Zinc finger |
IPR001965 | 454 | 500 | SM00249 | Zinc finger | |
IPR001965 | 531 | 582 | SM00249 | Zinc finger | |
IPR000910 | 1094 | 1158 | SM00398 | HMG1/2 (high mobility group) box | |
ProfileScan | IPR001965 | 402 | 455 | PS50016 | Zinc finger |
IPR001965 | 452 | 502 | PS50016 | Zinc finger | |
IPR001965 | 529 | 584 | PS50016 | Zinc finger | |
ScanRegExp | IPR001965 | 405 | 473 | PS01359 | Zinc finger |
IPR000194 | 851 | 860 | PS00152 | ATPase |
![]() |
Primer_f | GCCCTCCTTCATTTGTTCCTG |
---|---|
Primer_r | CTGGAGGTGCTGCTGGTAAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |