Order Kazusa clone(s) from : ![]() |
Product ID | ORK05868 |
---|---|
Accession No | AB040917 |
Description | leucine rich repeat and fibronectin type III domain containing 1 |
Clone name | fj06928 |
Vector information | |
cDNA sequence | DNA sequence (3174 bp) Predicted protein sequence (700 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1069 bp |
---|---|
Genome contig ID | gi42406306r_44389048 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 44489048 | 44497605 | 2 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 93 | 106 | PR00019 | Leucine-rich repeat |
IPR001611 | 138 | 151 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 19 | 41 | PF00560 | Leucine-rich repeat |
IPR001611 | 43 | 65 | PF00560 | Leucine-rich repeat | |
IPR001611 | 67 | 89 | PF00560 | Leucine-rich repeat | |
IPR001611 | 92 | 114 | PF00560 | Leucine-rich repeat | |
IPR001611 | 116 | 138 | PF00560 | Leucine-rich repeat | |
IPR013098 | 228 | 316 | PF07679 | Immunoglobulin I-set | |
IPR003961 | 355 | 431 | PF00041 | Fibronectin | |
HMMSmart | IPR003591 | 17 | 40 | SM00369 | Leucine-rich repeat |
IPR003591 | 41 | 64 | SM00369 | Leucine-rich repeat | |
IPR003591 | 65 | 88 | SM00369 | Leucine-rich repeat | |
IPR003591 | 90 | 113 | SM00369 | Leucine-rich repeat | |
IPR003591 | 114 | 137 | SM00369 | Leucine-rich repeat | |
IPR003591 | 138 | 162 | SM00369 | Leucine-rich repeat | |
IPR000483 | 181 | 226 | SM00082 | Cysteine-rich flanking region | |
IPR003599 | 235 | 317 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 241 | 306 | SM00408 | Immunoglobulin subtype 2 | |
IPR003961 | 351 | 431 | SM00060 | Fibronectin | |
ProfileScan | IPR007110 | 228 | 315 | PS50835 | Immunoglobulin-like |
IPR003961 | 350 | 441 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 464 | TMIIAIGGVIVASVLVFIVLLMI | 486 | PRIMARY | 23 |
![]() |
Primer_f | CAGACCAGGTGCCAACGATTC |
---|---|
Primer_r | CGAGGGAGTCATCAACGGAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CAGACCAGGTGCCAACGATTC |
Primer_r | CGAGGGAGTCATCAACGGAAC |
PCR product length | 155 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |