Order Kazusa clone(s) from : ![]() |
Product ID | ORK05661 |
---|---|
Accession No | AB040888 |
Description | teneurin transmembrane protein 3 |
Clone name | ef02451 |
Vector information | |
cDNA sequence | DNA sequence (7698 bp) Predicted protein sequence (2450 aa) |
Source | |
Rouge ID |
mKIAA1455
by Kazusa Mouse cDNA Project
|
Note | We replaced fh16070, former representative clones for KIAA1455 with ef02451. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 328 bp |
---|---|
Genome contig ID | gi89161207f_183686796 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (272032 - 272081) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 183762710 | 183958826 | 25 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR009471 | 2 | 59 | PF06484 | Teneurin intracellular |
IPR013111 | 269 | 295 | PF07974 | EGF | |
IPR013111 | 333 | 360 | PF07974 | EGF | |
IPR006209 | 365 | 392 | PF00008 | EGF-like | |
IPR013111 | 432 | 458 | PF07974 | EGF | |
IPR013111 | 463 | 489 | PF07974 | EGF | |
IPR006209 | 494 | 524 | PF00008 | EGF-like | |
IPR001258 | 923 | 951 | PF01436 | NHL repeat | |
IPR001258 | 970 | 989 | PF01436 | NHL repeat | |
IPR001258 | 1034 | 1059 | PF01436 | NHL repeat | |
IPR001258 | 1093 | 1119 | PF01436 | NHL repeat | |
IPR001258 | 1153 | 1180 | PF01436 | NHL repeat | |
IPR001258 | 1222 | 1249 | PF01436 | NHL repeat | |
IPR006530 | 1298 | 1335 | PF05593 | YD repeat | |
IPR006530 | 1361 | 1399 | PF05593 | YD repeat | |
IPR006530 | 1574 | 1610 | PF05593 | YD repeat | |
IPR006530 | 1904 | 1942 | PF05593 | YD repeat | |
IPR006530 | 1958 | 1996 | PF05593 | YD repeat | |
HMMSmart | IPR006210 | 268 | 296 | SM00181 | EGF |
IPR006210 | 299 | 327 | SM00181 | EGF | |
IPR006210 | 332 | 361 | SM00181 | EGF | |
IPR006210 | 364 | 393 | SM00181 | EGF | |
IPR006210 | 398 | 428 | SM00181 | EGF | |
IPR006210 | 431 | 459 | SM00181 | EGF | |
IPR006210 | 462 | 490 | SM00181 | EGF | |
IPR006210 | 493 | 525 | SM00181 | EGF | |
HMMTigr | IPR006530 | 1298 | 1339 | TIGR01643 | YD repeat |
IPR006530 | 1362 | 1403 | TIGR01643 | YD repeat | |
IPR006530 | 1574 | 1614 | TIGR01643 | YD repeat | |
IPR006530 | 1883 | 1924 | TIGR01643 | YD repeat | |
IPR006530 | 1958 | 2000 | TIGR01643 | YD repeat | |
ProfileScan | IPR000742 | 265 | 296 | PS50026 | EGF-like |
IPR000742 | 361 | 393 | PS50026 | EGF-like | |
IPR000742 | 395 | 428 | PS50026 | EGF-like | |
IPR000742 | 490 | 525 | PS50026 | EGF-like | |
ScanRegExp | IPR013032 | 284 | 295 | PS00022 | EGF-like region |
IPR013032 | 284 | 295 | PS01186 | EGF-like region | |
IPR013032 | 315 | 326 | PS00022 | EGF-like region | |
IPR013032 | 315 | 326 | PS01186 | EGF-like region | |
IPR013032 | 349 | 360 | PS00022 | EGF-like region | |
IPR013032 | 349 | 360 | PS01186 | EGF-like region | |
IPR013032 | 381 | 392 | PS00022 | EGF-like region | |
IPR013032 | 381 | 392 | PS01186 | EGF-like region | |
IPR013032 | 416 | 427 | PS00022 | EGF-like region | |
IPR013032 | 447 | 458 | PS00022 | EGF-like region | |
IPR013032 | 447 | 458 | PS01186 | EGF-like region | |
IPR013032 | 478 | 489 | PS00022 | EGF-like region | |
IPR013032 | 478 | 489 | PS01186 | EGF-like region | |
IPR013032 | 513 | 524 | PS00022 | EGF-like region | |
IPR013032 | 513 | 524 | PS01186 | EGF-like region |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 63 | LCAVGVSVLLAILLSYFIAMHLF | 85 | PRIMARY | 23 |
![]() |
Primer_f | AATGGCAGTTGATAAGAATGG |
---|---|
Primer_r | TGGTGTCACAAGTTAAAGGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATGGCAGTTGATAAGAATGG |
Primer_r | TGGTGTCACAAGTTAAAGGTC |
PCR product length | 137 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |