Order Kazusa clone(s) from : ![]() |
Product ID | ORK05494 |
---|---|
Accession No | AB037795 |
Description | intraflagellar transport 80 |
Clone name | fj04345 |
Vector information | |
cDNA sequence | DNA sequence (4044 bp) Predicted protein sequence (764 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1374
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1533 bp |
---|---|
Genome contig ID | gi89161205r_161357545 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99929 - 99880) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 161457474 | 161584138 | 19 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001680 | 15 | 29 | PR00320 | WD40 repeat |
IPR001680 | 108 | 122 | PR00320 | WD40 repeat | |
IPR001680 | 190 | 204 | PR00320 | WD40 repeat | |
HMMPfam | IPR001680 | 83 | 121 | PF00400 | WD40 repeat |
IPR001680 | 165 | 203 | PF00400 | WD40 repeat | |
IPR001680 | 206 | 243 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 82 | 121 | SM00320 | WD40 repeat |
IPR001680 | 123 | 163 | SM00320 | WD40 repeat | |
IPR001680 | 164 | 203 | SM00320 | WD40 repeat | |
IPR001680 | 205 | 243 | SM00320 | WD40 repeat | |
IPR001680 | 245 | 284 | SM00320 | WD40 repeat | |
IPR001680 | 483 | 520 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 89 | 121 | PS50082 | WD40 repeat |
IPR001680 | 89 | 212 | PS50294 | WD40 repeat | |
IPR001680 | 171 | 203 | PS50082 | WD40 repeat |
![]() |
Primer_f | TCATCAGAACTAGGAAAGCAC |
---|---|
Primer_r | TCTTCAGCAGTAGTCCAGCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGGGCGCTTTATTTCATCTCC |
Primer_r | TTCCATCACCTAACGGCTTTC |
PCR product length | 164(800) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |