Order Kazusa clone(s) from : ![]() |
Product ID | ORK05881 |
---|---|
Accession No | AB037786 |
Description | leucine rich repeat containing 7 |
Clone name | fj02517 |
Vector information | |
cDNA sequence | DNA sequence (4150 bp) Predicted protein sequence (831 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1365
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1594 bp |
---|---|
Genome contig ID | gi89161185f_70174429 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (187325 - 187374) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 70274429 | 70361752 | 8 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AACTGTAGCCCCTGTGATTTC |
---|---|
Primer_r | CTTTCTAACAGCAGTCTTTCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AACTGTAGCCCCTGTGATTTC |
Primer_r | CTTTCTAACAGCAGTCTTTCG |
PCR product length | 144 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |