Order Kazusa clone(s) from : ![]() |
Product ID | ORK00772 |
---|---|
Accession No | AB033051 |
Description | erbb2 interacting protein, transcript variant 2 |
Clone name | fh04221s1 |
Vector information | |
cDNA sequence | DNA sequence (6064 bp) Predicted protein sequence (1371 aa) |
Flexi ORF Clone | FXC00772 |
Source | Human fetal brain |
Rouge ID |
mKIAA1225
by Kazusa Mouse cDNA Project
|
Note | We replaced fh04221, former representative clones for KIAA1225 with fh04221s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1948 bp |
---|---|
Genome contig ID | gi51511721f_65224303 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (187761 - 187810) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 65324303 | 65412062 | 23 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 232 | 245 | PR00019 | Leucine-rich repeat |
IPR001611 | 367 | 380 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 47 | 68 | PF00560 | Leucine-rich repeat |
IPR001611 | 70 | 91 | PF00560 | Leucine-rich repeat | |
IPR001611 | 93 | 114 | PF00560 | Leucine-rich repeat | |
IPR001611 | 139 | 160 | PF00560 | Leucine-rich repeat | |
IPR001611 | 162 | 183 | PF00560 | Leucine-rich repeat | |
IPR001611 | 185 | 206 | PF00560 | Leucine-rich repeat | |
IPR001611 | 231 | 252 | PF00560 | Leucine-rich repeat | |
IPR001611 | 254 | 275 | PF00560 | Leucine-rich repeat | |
IPR001611 | 277 | 298 | PF00560 | Leucine-rich repeat | |
IPR001611 | 300 | 321 | PF00560 | Leucine-rich repeat | |
IPR001611 | 346 | 367 | PF00560 | Leucine-rich repeat | |
IPR001611 | 369 | 390 | PF00560 | Leucine-rich repeat | |
IPR001478 | 1282 | 1366 | PF00595 | PDZ/DHR/GLGF | |
HMMSmart | NULL | 45 | 63 | SM00365 | NULL |
NULL | 45 | 64 | SM00364 | NULL | |
IPR003591 | 48 | 68 | SM00369 | Leucine-rich repeat | |
NULL | 68 | 87 | SM00364 | NULL | |
NULL | 91 | 113 | SM00365 | NULL | |
NULL | 91 | 110 | SM00364 | NULL | |
IPR003591 | 91 | 114 | SM00369 | Leucine-rich repeat | |
IPR003591 | 137 | 159 | SM00369 | Leucine-rich repeat | |
NULL | 160 | 191 | SM00365 | NULL | |
IPR003591 | 160 | 182 | SM00369 | Leucine-rich repeat | |
NULL | 160 | 179 | SM00364 | NULL | |
NULL | 183 | 202 | SM00364 | NULL | |
IPR003591 | 183 | 205 | SM00369 | Leucine-rich repeat | |
NULL | 206 | 227 | SM00365 | NULL | |
IPR003591 | 206 | 228 | SM00369 | Leucine-rich repeat | |
IPR003591 | 229 | 252 | SM00369 | Leucine-rich repeat | |
NULL | 229 | 251 | SM00365 | NULL | |
NULL | 252 | 271 | SM00364 | NULL | |
IPR003591 | 253 | 274 | SM00369 | Leucine-rich repeat | |
IPR003591 | 275 | 298 | SM00369 | Leucine-rich repeat | |
NULL | 275 | 294 | SM00364 | NULL | |
IPR003591 | 321 | 344 | SM00369 | Leucine-rich repeat | |
NULL | 345 | 363 | SM00364 | NULL | |
IPR003591 | 345 | 366 | SM00369 | Leucine-rich repeat | |
NULL | 367 | 386 | SM00364 | NULL | |
NULL | 367 | 385 | SM00365 | NULL | |
IPR003591 | 367 | 389 | SM00369 | Leucine-rich repeat | |
NULL | 390 | 411 | SM00365 | NULL | |
IPR001478 | 1289 | 1369 | SM00228 | PDZ/DHR/GLGF | |
ProfileScan | IPR001478 | 1280 | 1369 | PS50106 | PDZ/DHR/GLGF |
![]() |
Primer_f | TTCGAGCTAATACTGCATACC |
---|---|
Primer_r | TCACCAAGATTTACAGAGGCT |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |