Order Kazusa clone(s) from : ![]() |
Product ID | ORK00214 |
---|---|
Accession No | AB037752 |
Description | SUMO1/sentrin/SMT3 specific peptidase 2 |
Clone name | fh15253s1 |
Vector information | |
cDNA sequence | DNA sequence (5803 bp) Predicted protein sequence (589 aa) |
HaloTag ORF Clone |
FHC00214
![]() |
Flexi ORF Clone | FXC00214 |
Source | Human fetal brain |
Rouge ID |
mKIAA1331
by Kazusa Mouse cDNA Project
|
Note | We replaced fh15253, former representative clones for KIAA1331 with fh15253s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GTTCAGCGTATTCATTCACTC |
---|---|
Primer_r | GTGGCAGCTTGAGTAACATTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |