ROUGE |
Gene/Protein Characteristic Table for mKIAA1331 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC031652 |
---|---|
Sentrin-specific protease 2. | |
mbh03238 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2898 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1180 bp Genome contig ID gi65546577f_20682375 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGCTTTTATGACGTAATAAAAGACTGGCAGAACCTFlanking genome sequence
(138287 - 138336) ----+----*----+----*----+----*----+----*----+----*
AGAGTATATTCTGATAATTTTTCCTCTTTTCTCTGCCTCAACCTTCCAAA
KIAA Alignment based on: KIAA1331 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1718
Length: 571 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |