KIAA1237

Product ID	ORK05411
Accession No	AB033063
Description	heart development protein with EGF-like domains 1
Clone name	fh09696s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-2000) was subcloned upstream of the cDNA (3127-6250). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA.
cDNA sequence	DNA sequence (6985 bp) Predicted protein sequence (1268 aa)
Source	Human fetal brain
Rouge ID	mKIAA1237 by Kazusa Mouse cDNA Project
Note	We replaced fh09696, former representative clones for KIAA1237 with fh09696s1. (2003/8/28)

Length: 6985 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3176 bp
Genome contig ID	gi89161205r_126069011
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTAAGAAGTAACCAAATTAGTGACGTGAAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATGCTGACTACCCTTTTGAAAATGTGCTTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	126169011	126231001	16	99.3	Perfect prediction

Length: 1268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ULI3	0	99.8	Protein HEG hom...	Homo sapiens
BAG10442	0	92.4	HEG homolog 1 [...	synthetic construct
XP_589074	0	65.8	similar to Prot...	Bos taurus
XP_516708	0	98.4	HEG homolog 1 [...	Pan troglodytes
XP_545138	3.4e-164	62.5	similar to HEG ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006209	876	909	PF00008	EGF-like
HMMPfam	IPR013091	912	949	PF07645	EGF calcium-binding
HMMSmart	IPR001881	872	910	SM00179	EGF-like calcium-binding
	IPR006210	875	910	SM00181	EGF
	IPR001881	912	950	SM00179	EGF-like calcium-binding
	IPR006210	915	950	SM00181	EGF
	IPR006210	1070	1118	SM00181	EGF
ProfileScan	IPR000742	872	910	PS50026	EGF-like
ProfileScan	IPR000742	912	950	PS50026	EGF-like
ScanRegExp	IPR013032	898	909	PS00022	EGF-like region
	IPR001881	905	936	PS01187	EGF-like calcium-binding
	IPR000152	927	938	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	936	949	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1136	ITVVIAAAGGGLLLILGIALIVT	1158	PRIMARY	23

Primer_f	CCGTATGGAGTGGATTAAGAG
Primer_r	CTGGAAACTGTGGAGACTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-