Order Kazusa clone(s) from : ![]() |
Product ID | ORK05411 |
---|---|
Accession No | AB033063 |
Description | heart development protein with EGF-like domains 1 |
Clone name | fh09696s1 |
Vector information | |
cDNA sequence | DNA sequence (6985 bp) Predicted protein sequence (1268 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1237
by Kazusa Mouse cDNA Project
|
Note | We replaced fh09696, former representative clones for KIAA1237 with fh09696s1. (2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3176 bp |
---|---|
Genome contig ID | gi89161205r_126069011 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 126169011 | 126231001 | 16 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006209 | 876 | 909 | PF00008 | EGF-like |
IPR013091 | 912 | 949 | PF07645 | EGF calcium-binding | |
HMMSmart | IPR001881 | 872 | 910 | SM00179 | EGF-like calcium-binding |
IPR006210 | 875 | 910 | SM00181 | EGF | |
IPR001881 | 912 | 950 | SM00179 | EGF-like calcium-binding | |
IPR006210 | 915 | 950 | SM00181 | EGF | |
IPR006210 | 1070 | 1118 | SM00181 | EGF | |
ProfileScan | IPR000742 | 872 | 910 | PS50026 | EGF-like |
IPR000742 | 912 | 950 | PS50026 | EGF-like | |
ScanRegExp | IPR013032 | 898 | 909 | PS00022 | EGF-like region |
IPR001881 | 905 | 936 | PS01187 | EGF-like calcium-binding | |
IPR000152 | 927 | 938 | PS00010 | Aspartic acid and asparagine hydroxylation site | |
IPR013032 | 936 | 949 | PS01186 | EGF-like region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1136 | ITVVIAAAGGGLLLILGIALIVT | 1158 | PRIMARY | 23 |
---|
![]() |
Primer_f | CCGTATGGAGTGGATTAAGAG |
---|---|
Primer_r | CTGGAAACTGTGGAGACTGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |