KIAA1016

Product ID	ORK00166
Accession No	AB023233
Description	leucine-rich repeats and calponin homology (CH) domain containing 1, transcript variant 2
Clone name	hk03719s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The adjacent sequence to the 5' end of the cDNA is as follows: TCGACCCACG CGTCCGCGGA CGCGTGGG-5' end of cDNA. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4131 bp) Predicted protein sequence (793 aa)
HaloTag ORF Clone	FHC00166
Flexi ORF Clone	FXC00166
Source	Human adult brain
Rouge ID	mKIAA1016 by Kazusa Mouse cDNA Project
Note	We replaced hk03719, former representative clones for KIAA1016 with hk03719s1. (2002/5/10)

Length: 4131 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1747 bp
Genome contig ID	gi51511729f_45925336
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCATAAATTGCTTAATAAACACATTTTGGGTGATT
Flanking genome sequence (290397 - 290446)	----+--------+--------+--------+--------+----* ATTCCAAGTTTTTATCAGCCCATTGATACATGTATTCATGAGCTCTCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	46025336	46215731	19	99.3	Perfect prediction

Length: 793 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2L9	100.0	Leucine-rich re...	Homo sapiens
CAH73642	99.0	leucine-rich re...	Homo sapiens
CAH92381	98.4	hypothetical pr...	Pongo abelii
XP_001915067	93.2	leucine-rich re...	Equus caballus
AAK95567	99.1	neuronal protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040928	1.5e-18	41.0	KIAA1495
AB020669	2e-06	35.1	KIAA0862
AB033051	2.6e-06	23.0	KIAA1225
D63481	1.9e-05	31.0	KIAA0147
AB037858	6.8e-05	30.4	KIAA1437

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	210	223	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	252	265	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	186	207	PF00560	Leucine-rich repeat
	IPR001611	209	230	PF00560	Leucine-rich repeat
	IPR001611	231	252	PF00560	Leucine-rich repeat
	IPR001611	254	275	PF00560	Leucine-rich repeat
	IPR001611	277	298	PF00560	Leucine-rich repeat
	IPR001715	642	757	PF00307	Calponin-like actin-binding
HMMSmart	IPR003591	184	206	SM00369	Leucine-rich repeat
	NULL	207	226	SM00364	NULL
	IPR003591	207	230	SM00369	Leucine-rich repeat
	NULL	232	248	SM00364	NULL
	IPR003591	252	274	SM00369	Leucine-rich repeat
	NULL	252	271	SM00364	NULL
	NULL	275	294	SM00364	NULL
	IPR003591	275	298	SM00369	Leucine-rich repeat
	IPR003591	320	343	SM00369	Leucine-rich repeat
	IPR001715	643	752	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	641	754	PS50021	Calponin-like actin-binding
ScanRegExp	IPR002114	534	549	PS00589	Phosphotransferase system

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	767	DLIGFCLVHILFIVLVYITYHWN	789	PRIMARY	23

Primer_f	GCAGGGTATGTGGAAGTTATC
Primer_r	CAGGGTGCTCATTAGACATCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCAGGGTATGTGGAAGTTATC
Primer_r	CAGGGTGCTCATTAGACATCG
PCR product length	143 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles