KIAA1200

Product ID	ORK00763
Accession No	AB033026
Description	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Clone name	fg02656
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6512 bp) Predicted protein sequence (1403 aa)
HaloTag ORF Clone	FHC00763
Flexi ORF Clone	FXC00763
Source	Human fetal brain
Rouge ID	mKIAA1200 by Kazusa Mouse cDNA Project

Length: 6512 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2299 bp
Genome contig ID	gi51511730f_66969785
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GTTTGTCAATAAAAAGCAGCTATCTGTGAACCAGG
Flanking genome sequence (156221 - 156270)	----+--------+--------+--------+--------+----* TAACTGTGTGTTTTGGAAGATCTGTTTATTAACAGTAAATAAATAAGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	67069785	67126004	29	99.5	Perfect prediction

Length: 1403 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW80940	99.9	pleckstrin homo...	Homo sapiens
Q9ULM0	100.0	Pleckstrin homo...	Homo sapiens
XP_001916221	86.5	pleckstrin homo...	Equus caballus
XP_537487	85.7	similar to plec...	Canis lupus fam...
XP_001925997	86.4	pleckstrin homo...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095948	1.1e-121	48.4	KIAA2028

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	618	711	PF00169	Pleckstrin-like
	IPR001849	727	835	PF00169	Pleckstrin-like
	IPR000857	913	1025	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
HMMSmart	IPR001849	618	713	SM00233	Pleckstrin-like
	IPR001849	727	837	SM00233	Pleckstrin-like
	IPR000857	871	1025	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	1032	1269	SM00295	Band 4.1
ProfileScan	IPR001849	617	711	PS50003	Pleckstrin-like
	IPR001849	726	835	PS50003	Pleckstrin-like
	IPR000857	871	1025	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	1036	1372	PS50057	Band 4.1

Primer_f	GGCAGCCTTACTATATGTCAG
Primer_r	CATGCTTGTCAGTTTACGGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGCAGCCTTACTATATGTCAG
Primer_r	CATGCTTGTCAGTTTACGGGG
PCR product length	190 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles