KIAA1190

Product ID	ORK07401
Accession No	AB033016
Description	zinc finger and BTB domain containing 47
Clone name	hg03443a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3510 bp) Predicted protein sequence (174 aa)
Source	Human adult brain

Length: 3510 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2983 bp
Genome contig ID	gi89161205f_42580291
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGGATGAAGGGGAATAAAGTCAGTACAACTCGTG
Flanking genome sequence (103787 - 103836)	----+--------+--------+--------+--------+----* TCCCTTGGCCCAGCCTCTTCTTTGCACTTGGCCTGCCTTGACTCTTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	42679604	42684076	3	99.0	Perfect prediction

Length: 174 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UFB7	7.1e-57	100.0	Zinc finger and...	Homo sapiens
BAC86810	1e-56	100.0	unnamed protein...	Homo sapiens
BAG10435	1e-56	100.0	zinc finger and...	synthetic construct
BAE01432	4.5e-55	97.1	unnamed protein...	Macaca fascicularis
XP_851976	3.1e-46	86.2	similar to natu...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023141	2.2e-20	68.0	KIAA0924
AB037760	3.6e-07	39.3	KIAA1339
AB075849	4.9e-07	47.2	KIAA1969
AB075862	5.3e-07	46.2	KIAA1982
D31763	5.6e-07	47.2	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	59	82	PD000003	Zinc finger
HMMPfam	IPR007087	3	25	PF00096	Zinc finger
	IPR007087	31	53	PF00096	Zinc finger
	IPR007087	59	81	PF00096	Zinc finger
	IPR007087	87	109	PF00096	Zinc finger
HMMSmart	IPR015880	3	25	SM00355	Zinc finger
	IPR015880	31	53	SM00355	Zinc finger
	IPR015880	59	81	SM00355	Zinc finger
	IPR015880	87	114	SM00355	Zinc finger
ProfileScan	IPR007087	3	30	PS50157	Zinc finger
	IPR007087	31	58	PS50157	Zinc finger
	IPR007087	59	86	PS50157	Zinc finger
	IPR007087	87	115	PS50157	Zinc finger
ScanRegExp	IPR007087	5	25	PS00028	Zinc finger
	IPR007087	33	53	PS00028	Zinc finger
	IPR007087	61	81	PS00028	Zinc finger

Primer_f	AAAGTTGATCTCTCCCAGTGG
Primer_r	AGGACAGGGTTTCATTGCCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-