KIAA1138

Gene/Protein Characteristic Table for KIAA1138

Order Kazusa clone(s) from :

Product ID	ORK00748
Accession No	AB032964
Description	REX1, RNA exonuclease 1 homolog
Clone name	hj05928
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4566 bp) Predicted protein sequence (1239 aa)
HaloTag ORF Clone	FHC00748
Flexi ORF Clone	FXC00748
Source	Human adult brain
Rouge ID	mKIAA1138 by Kazusa Mouse cDNA Project

Length: 4566 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	817 bp
Genome contig ID	gi42406306r_1666248
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CAGGCAGGGACAGAATAAATGTTTGTATGGATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTTTGTGGTGGTCTTGGTCTTGGTGCCTGGTGAGGCCTCTGCATGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	1766248	1799440	16	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 1239 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N1G1	100.0	RNA exonuclease...	Homo sapiens
AAH32244	99.9	REX1, RNA exonu...	Homo sapiens
NP_065746	99.8	transcription e...	Homo sapiens
EAW69451	99.8	REX1, RNA exonu...	Homo sapiens
EAW69450	99.5	REX1, RNA exonu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000116	406	476	PD005593	High mobility group proteins HMG-I and HMG-Y
HMMPfam	IPR013520	1078	1227	PF00929	Exonuclease
HMMSmart	IPR006055	1077	1236	SM00479	Exonuclease

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ACCATCATCCCTAAGCGAATC
Primer_r	TCGTTCAGTGCCTTCTCTATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 19

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CATGCCTCTTCCAAAACAGTG
Primer_r	GTCTCCATCAGCAGCAGTTTC
PCR product length	202 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp