Order Kazusa clone(s) from : ![]() |
Product ID | ORK01140 |
---|---|
Accession No | AB023187 |
Description | fibronectin type III domain containing 3A, transcript variant 2 |
Clone name | hh13674 |
Vector information | |
cDNA sequence | DNA sequence (5844 bp) Predicted protein sequence (1151 aa) |
HaloTag ORF Clone |
FHC01140
![]() |
Flexi ORF Clone | FXC01140 |
Source | Human adult brain |
Rouge ID |
mKIAA0970
by Kazusa Mouse cDNA Project
|
Note | We replaced hj06711, former representative clones for KIAA0970 with hh13674. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2388 bp |
---|---|
Genome contig ID | gi51511729f_48486791 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (195128 - 195177) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | f | 48582510 | 48681917 | 24 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR003962 | 338 | 347 | PR00014 | Fibronectin |
IPR003962 | 546 | 556 | PR00014 | Fibronectin | |
IPR003962 | 666 | 684 | PR00014 | Fibronectin | |
IPR003962 | 684 | 698 | PR00014 | Fibronectin | |
HMMPfam | IPR003961 | 219 | 312 | PF00041 | Fibronectin |
IPR003961 | 324 | 408 | PF00041 | Fibronectin | |
IPR003961 | 420 | 505 | PF00041 | Fibronectin | |
IPR003961 | 517 | 603 | PF00041 | Fibronectin | |
IPR003961 | 614 | 700 | PF00041 | Fibronectin | |
IPR003961 | 712 | 794 | PF00041 | Fibronectin | |
IPR003961 | 831 | 893 | PF00041 | Fibronectin | |
IPR003961 | 959 | 988 | PF00041 | Fibronectin | |
HMMSmart | IPR003961 | 219 | 311 | SM00060 | Fibronectin |
IPR003961 | 324 | 405 | SM00060 | Fibronectin | |
IPR003961 | 420 | 502 | SM00060 | Fibronectin | |
IPR003961 | 517 | 600 | SM00060 | Fibronectin | |
IPR003961 | 615 | 697 | SM00060 | Fibronectin | |
IPR003961 | 712 | 791 | SM00060 | Fibronectin | |
IPR003961 | 817 | 890 | SM00060 | Fibronectin | |
IPR003961 | 904 | 985 | SM00060 | Fibronectin | |
IPR003961 | 1000 | 1080 | SM00060 | Fibronectin | |
ProfileScan | IPR003961 | 218 | 318 | PS50853 | Fibronectin |
IPR003961 | 324 | 415 | PS50853 | Fibronectin | |
IPR003961 | 420 | 511 | PS50853 | Fibronectin | |
IPR003961 | 517 | 610 | PS50853 | Fibronectin | |
IPR003961 | 614 | 707 | PS50853 | Fibronectin | |
IPR003961 | 711 | 801 | PS50853 | Fibronectin | |
IPR003961 | 802 | 900 | PS50853 | Fibronectin | |
IPR003961 | 904 | 995 | PS50853 | Fibronectin | |
IPR003961 | 1000 | 1090 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1125 | QCAAVILVLFAFFSILIAFIIQY | 1147 | PRIMARY | 23 |
---|
![]() |
Primer_f | TCCCATAACTGCTGCCACCAC |
---|---|
Primer_r | AGCTTGAAGTTTACTGGTGCA |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |