KIAA0970

Product ID	ORK01140
Accession No	AB023187
Description	fibronectin type III domain containing 3A, transcript variant 2
Clone name	hh13674
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5844 bp) Predicted protein sequence (1151 aa)
HaloTag ORF Clone	FHC01140
Flexi ORF Clone	FXC01140
Source	Human adult brain
Rouge ID	mKIAA0970 by Kazusa Mouse cDNA Project
Note	We replaced hj06711, former representative clones for KIAA0970 with hh13674. (2001/5/29)

Length: 5844 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2388 bp
Genome contig ID	gi51511729f_48486791
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CCAGTAAAGAATAAAATTAGAAGTTTTATCCTAGG
Flanking genome sequence (195128 - 195177)	----+--------+--------+--------+--------+----* TGACTTGATTTTGTGCAACTCATGAAATATCTTACTTCCTTTCCACATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	48582510	48681917	24	99.5	Perfect prediction

Length: 1151 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX08804	100.0	fibronectin typ...	Homo sapiens
CAI45989	99.8	hypothetical pr...	Homo sapiens
CAG44602	99.8	human gene expr...	Homo sapiens
XP_001152472	99.7	fibronectin typ...	Pan troglodytes
XP_001152540	99.6	fibronectin typ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040947	1.2e-05	24.8	KIAA1514
AB006621	0.00021	24.7	KIAA0283

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003962	338	347	PR00014	Fibronectin
	IPR003962	546	556	PR00014	Fibronectin
	IPR003962	666	684	PR00014	Fibronectin
	IPR003962	684	698	PR00014	Fibronectin
HMMPfam	IPR003961	219	312	PF00041	Fibronectin
	IPR003961	324	408	PF00041	Fibronectin
	IPR003961	420	505	PF00041	Fibronectin
	IPR003961	517	603	PF00041	Fibronectin
	IPR003961	614	700	PF00041	Fibronectin
	IPR003961	712	794	PF00041	Fibronectin
	IPR003961	831	893	PF00041	Fibronectin
	IPR003961	959	988	PF00041	Fibronectin
HMMSmart	IPR003961	219	311	SM00060	Fibronectin
	IPR003961	324	405	SM00060	Fibronectin
	IPR003961	420	502	SM00060	Fibronectin
	IPR003961	517	600	SM00060	Fibronectin
	IPR003961	615	697	SM00060	Fibronectin
	IPR003961	712	791	SM00060	Fibronectin
	IPR003961	817	890	SM00060	Fibronectin
	IPR003961	904	985	SM00060	Fibronectin
	IPR003961	1000	1080	SM00060	Fibronectin
ProfileScan	IPR003961	218	318	PS50853	Fibronectin
	IPR003961	324	415	PS50853	Fibronectin
	IPR003961	420	511	PS50853	Fibronectin
	IPR003961	517	610	PS50853	Fibronectin
	IPR003961	614	707	PS50853	Fibronectin
	IPR003961	711	801	PS50853	Fibronectin
	IPR003961	802	900	PS50853	Fibronectin
	IPR003961	904	995	PS50853	Fibronectin
	IPR003961	1000	1090	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1125	QCAAVILVLFAFFSILIAFIIQY	1147	PRIMARY	23

Primer_f	TCCCATAACTGCTGCCACCAC
Primer_r	AGCTTGAAGTTTACTGGTGCA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-