Order Kazusa clone(s) from : ![]() |
Product ID | ORK04858 |
---|---|
Accession No | AB020710 |
Description | EH domain binding protein 1 |
Clone name | hk09970 |
Vector information | |
cDNA sequence | DNA sequence (3875 bp) Predicted protein sequence (962 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0903
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 984 bp |
---|---|
Genome contig ID | gi89161199f_62839874 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (287251 - 287300) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 62939874 | 63127123 | 17 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CACCAGTTTACAAAGACAGTC |
---|---|
Primer_r | TTCGTGAGCCAATGTTGAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CACCAGTTTACAAAGACAGTC |
Primer_r | TTCGTGAGCCAATGTTGAGAC |
PCR product length | 119 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |