KIAA0903

Product ID	ORK04858
Accession No	AB020710
Description	EH domain binding protein 1
Clone name	hk09970
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3875 bp) Predicted protein sequence (962 aa)
Source	Human adult brain
Rouge ID	mKIAA0903 by Kazusa Mouse cDNA Project

Length: 3875 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	984 bp
Genome contig ID	gi89161199f_62839874
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TAAATTTTCAATAAAAGCAGAAACTTTCTTACCTT
Flanking genome sequence (287251 - 287300)	----+--------+--------+--------+--------+----* AAACACGGCTGCTACTTTCTTGCAATGAAAACTTGACATTGGCTTGAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	62939874	63127123	17	99.7	Perfect prediction

Length: 962 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAS48537	100.0	EH domain bindi...	Homo sapiens
Q8NDI1	100.0	EH domain-bindi...	Homo sapiens
EAW99970	100.0	EH domain bindi...	Homo sapiens
CAD38814	99.9	hypothetical pr...	Homo sapiens
XP_001162250	99.7	EH domain bindi...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020626	1.9e-07	22.6	KIAA0819
AB037785	8.4e-07	40.9	KIAA1364
AB018293	9.9e-07	29.0	KIAA0750
AB051455	2e-06	23.6	KIAA1668
AB008567	2.8e-05	23.0	KIAA0302

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001715	175	279	PF00307	Calponin-like actin-binding
HMMSmart	IPR001715	176	274	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	174	276	PS50021	Calponin-like actin-binding

Primer_f	CACCAGTTTACAAAGACAGTC
Primer_r	TTCGTGAGCCAATGTTGAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CACCAGTTTACAAAGACAGTC
Primer_r	TTCGTGAGCCAATGTTGAGAC
PCR product length	119 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles