Order Kazusa clone(s) from : ![]() |
Product ID | ORK04592 |
---|---|
Accession No | AB020709 |
Description | connector enhancer of kinase suppressor of Ras 2 |
Clone name | hk09777 |
Vector information | |
cDNA sequence | DNA sequence (4349 bp) Predicted protein sequence (910 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0902
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1211 bp |
---|---|
Genome contig ID | gi89161218f_21202481 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (368294 - 368343) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001660 | 26 | 90 | PF00536 | Sterile alpha motif SAM |
IPR001478 | 234 | 311 | PF00595 | PDZ/DHR/GLGF | |
IPR010599 | 349 | 532 | PF06663 | Connector enhancer of kinase suppressor of ras 2 | |
IPR001849 | 588 | 686 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001660 | 25 | 93 | SM00454 | Sterile alpha motif SAM |
IPR001478 | 242 | 314 | SM00228 | PDZ/DHR/GLGF | |
IPR001849 | 588 | 688 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001660 | 28 | 93 | PS50105 | Sterile alpha motif SAM |
IPR001478 | 232 | 314 | PS50106 | PDZ/DHR/GLGF | |
IPR001849 | 587 | 686 | PS50003 | Pleckstrin-like |
![]() |
Primer_f | AATCTATAGGCTGTGGGTTTC |
---|---|
Primer_r | ATTGATTGAGCCATAGGGGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATCTATAGGCTGTGGGTTTC |
Primer_r | ATTGATTGAGCCATAGGGGAC |
PCR product length | 113 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |