KIAA0403

Product ID	ORK05597
Accession No	AB007863
Description	interaction protein for cytohesin exchange factors 1
Clone name	hg01159
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6467 bp) Predicted protein sequence (416 aa)
Source	Human adult brain
Rouge ID	mKIAA0403 by Kazusa Mouse cDNA Project

Length: 6467 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5216 bp
Genome contig ID	gi89161210r_154417438
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTCTCAAAGAAATAAACATGTGGCTGGAAGTGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGCTGCGTTTTGATCGTCTACAACAAGGTTACAGTGCCCTCTGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	154517438	154609588	8	99.2	Terminal No-hit

Length: 416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8WWN9	3e-143	100.0	Interactor prot...	Homo sapiens
BAF82606	3e-143	100.0	unnamed protein...	Homo sapiens
CAI46054	5.8e-143	99.8	hypothetical pr...	Homo sapiens
XP_527543	2.6e-141	99.0	hypothetical pr...	Pan troglodytes
EAW47702	7.9e-141	100.0	phosphoinositid...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020709	2.7e-17	38.1	KIAA0902
AB051473	0.0008	26.0	KIAA1686

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	21	119	PF00169	Pleckstrin-like
HMMSmart	IPR001849	21	121	SM00233	Pleckstrin-like
ProfileScan	IPR001849	20	119	PS50003	Pleckstrin-like

Primer_f	TGCAGGACAAAAATGAACACC
Primer_r	TTACTGTGCTCTCATCCTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCAGGACAAAAATGAACACC
Primer_r	TTACTGTGCTCTCATCCTGTG
PCR product length	188 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles