Order Kazusa clone(s) from : ![]() |
Product ID | ORK05597 |
---|---|
Accession No | AB007863 |
Description | interaction protein for cytohesin exchange factors 1 |
Clone name | hg01159 |
Vector information | |
cDNA sequence | DNA sequence (6467 bp) Predicted protein sequence (416 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0403
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 5216 bp |
---|---|
Genome contig ID | gi89161210r_154417438 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 154517438 | 154609588 | 8 | 99.2 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | TGCAGGACAAAAATGAACACC |
---|---|
Primer_r | TTACTGTGCTCTCATCCTGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCAGGACAAAAATGAACACC |
Primer_r | TTACTGTGCTCTCATCCTGTG |
PCR product length | 188 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |