Order Kazusa clone(s) from : ![]() |
Product ID | ORK04796 |
---|---|
Accession No | AB020663 |
Description | Dmx-like 2 |
Clone name | bf00171 |
Vector information | |
cDNA sequence | DNA sequence (7912 bp) Predicted protein sequence (2237 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0856
by Kazusa Mouse cDNA Project
|
Note | We replaced hk06221, former representative clones for KIAA0856 with bf00171. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1196 bp |
---|---|
Genome contig ID | gi51511731r_49427277 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 49527277 | 49615189 | 31 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 202 | 228 | PF00400 | WD40 repeat |
IPR001680 | 2091 | 2129 | PF00400 | WD40 repeat | |
IPR001680 | 2133 | 2171 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 187 | 228 | SM00320 | WD40 repeat |
IPR001680 | 435 | 472 | SM00320 | WD40 repeat | |
IPR001680 | 1957 | 1992 | SM00320 | WD40 repeat | |
IPR001680 | 1996 | 2035 | SM00320 | WD40 repeat | |
IPR001680 | 2042 | 2084 | SM00320 | WD40 repeat | |
IPR001680 | 2090 | 2129 | SM00320 | WD40 repeat | |
IPR001680 | 2132 | 2171 | SM00320 | WD40 repeat | |
IPR001680 | 2184 | 2222 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 1960 | 2180 | PS50294 | WD40 repeat |
IPR001680 | 2097 | 2138 | PS50082 | WD40 repeat | |
IPR001680 | 2139 | 2180 | PS50082 | WD40 repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1542 | NILLCEAVVAVYLSLLIHALATN | 1564 | PRIMARY | 23 |
---|
![]() |
Primer_f | GGCCAGTTAATAGTTGATGAG |
---|---|
Primer_r | CCACACAGGCATTGAACATTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |