Order Kazusa clone(s) from : ![]() |
Product ID | ORK00659 |
---|---|
Accession No | AB020661 |
Description | zinc fingers and homeoboxes 2 |
Clone name | hk06169 |
Vector information | |
cDNA sequence | DNA sequence (4089 bp) Predicted protein sequence (868 aa) |
HaloTag ORF Clone |
FHC00659
![]() |
Flexi ORF Clone | FXC00659 |
Source | Human adult brain |
Rouge ID |
mKIAA0854
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1271 bp |
---|---|
Genome contig ID | gi51511724f_123844895 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (211036 - 211085) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 123944888 | 124055929 | 3 | 98.9 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001356 | 474 | 527 | PF00046 | Homeobox |
IPR001356 | 563 | 616 | PF00046 | Homeobox | |
IPR001356 | 660 | 716 | PF00046 | Homeobox | |
HMMSmart | IPR015880 | 109 | 132 | SM00355 | Zinc finger |
IPR015880 | 141 | 164 | SM00355 | Zinc finger | |
IPR001356 | 294 | 355 | SM00389 | Homeobox | |
IPR001356 | 470 | 532 | SM00389 | Homeobox | |
IPR001356 | 561 | 622 | SM00389 | Homeobox | |
IPR001356 | 659 | 721 | SM00389 | Homeobox | |
ProfileScan | IPR007087 | 141 | 169 | PS50157 | Zinc finger |
IPR001356 | 478 | 528 | PS50071 | Homeobox | |
IPR001356 | 568 | 618 | PS50071 | Homeobox | |
IPR001356 | 667 | 717 | PS50071 | Homeobox |
![]() |
Primer_f | CACCTTTCTAAATACCAGCAG |
---|---|
Primer_r | TACCACACCGAGAAAAGGCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |