Order Kazusa clone(s) from : ![]() |
Product ID | ORK06290 |
---|---|
Accession No | AB020631 |
Description | PCF11 cleavage and polyadenylation factor subunit |
Clone name | hh02773 |
Vector information | |
cDNA sequence | DNA sequence (5834 bp) Predicted protein sequence (1644 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0824
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 897 bp |
---|---|
Genome contig ID | gi51511727f_82445861 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (128622 - 128671) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 82545861 | 82574481 | 16 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTCAAAAGGGGGTTCCGAGAG |
---|---|
Primer_r | ATACCTGGAGATGTGTTTGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCAAAAGGGGGTTCCGAGAG |
Primer_r | ATACCTGGAGATGTGTTTGTG |
PCR product length | 137 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |