Order Kazusa clone(s) from : ![]() |
Product ID | ORK00627 |
---|---|
Accession No | AB018303 |
Description | zinc finger protein 423, transcript variant 2 |
Clone name | hk04642s1 |
Vector information | |
cDNA sequence | DNA sequence (4248 bp) Predicted protein sequence (1224 aa) |
HaloTag ORF Clone |
FHC00627
![]() |
Flexi ORF Clone | FXC00627 |
Source | Human adult brain |
Rouge ID |
mKIAA0760
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04642, former representative clones for KIAA0760 with hk04642s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 573 bp |
---|---|
Genome contig ID | gi51511732r_47982115 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 48082115 | 48322279 | 6 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 134 | 157 | PD000003 | Zinc finger |
HMMPfam | IPR007087 | 78 | 100 | PF00096 | Zinc finger |
IPR007087 | 106 | 128 | PF00096 | Zinc finger | |
IPR007087 | 134 | 156 | PF00096 | Zinc finger | |
IPR007087 | 162 | 184 | PF00096 | Zinc finger | |
IPR007087 | 203 | 226 | PF00096 | Zinc finger | |
IPR007087 | 349 | 373 | PF00096 | Zinc finger | |
IPR007087 | 381 | 404 | PF00096 | Zinc finger | |
IPR007087 | 420 | 443 | PF00096 | Zinc finger | |
IPR007087 | 572 | 594 | PF00096 | Zinc finger | |
IPR007087 | 602 | 624 | PF00096 | Zinc finger | |
IPR007087 | 632 | 655 | PF00096 | Zinc finger | |
IPR007087 | 660 | 683 | PF00096 | Zinc finger | |
IPR007087 | 690 | 713 | PF00096 | Zinc finger | |
IPR007087 | 721 | 743 | PF00096 | Zinc finger | |
IPR007087 | 826 | 849 | PF00096 | Zinc finger | |
IPR007087 | 870 | 892 | PF00096 | Zinc finger | |
IPR007087 | 899 | 921 | PF00096 | Zinc finger | |
IPR007087 | 1060 | 1083 | PF00096 | Zinc finger | |
IPR007087 | 1138 | 1160 | PF00096 | Zinc finger | |
IPR007087 | 1169 | 1192 | PF00096 | Zinc finger | |
IPR007087 | 1199 | 1222 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 7 | 28 | SM00355 | Zinc finger |
IPR015880 | 78 | 100 | SM00355 | Zinc finger | |
IPR015880 | 106 | 128 | SM00355 | Zinc finger | |
IPR015880 | 134 | 156 | SM00355 | Zinc finger | |
IPR015880 | 162 | 184 | SM00355 | Zinc finger | |
IPR015880 | 203 | 226 | SM00355 | Zinc finger | |
IPR015880 | 235 | 258 | SM00355 | Zinc finger | |
IPR015880 | 263 | 285 | SM00355 | Zinc finger | |
IPR015880 | 349 | 373 | SM00355 | Zinc finger | |
IPR015880 | 381 | 404 | SM00355 | Zinc finger | |
IPR015880 | 420 | 443 | SM00355 | Zinc finger | |
IPR015880 | 457 | 480 | SM00355 | Zinc finger | |
IPR015880 | 503 | 528 | SM00355 | Zinc finger | |
IPR015880 | 572 | 594 | SM00355 | Zinc finger | |
IPR015880 | 602 | 624 | SM00355 | Zinc finger | |
IPR015880 | 632 | 655 | SM00355 | Zinc finger | |
IPR015880 | 660 | 683 | SM00355 | Zinc finger | |
IPR015880 | 690 | 713 | SM00355 | Zinc finger | |
IPR015880 | 721 | 743 | SM00355 | Zinc finger | |
IPR015880 | 747 | 770 | SM00355 | Zinc finger | |
IPR015880 | 826 | 849 | SM00355 | Zinc finger | |
IPR015880 | 870 | 892 | SM00355 | Zinc finger | |
IPR015880 | 899 | 921 | SM00355 | Zinc finger | |
IPR015880 | 928 | 950 | SM00355 | Zinc finger | |
IPR015880 | 960 | 982 | SM00355 | Zinc finger | |
IPR015880 | 1060 | 1083 | SM00355 | Zinc finger | |
IPR015880 | 1108 | 1130 | SM00355 | Zinc finger | |
IPR015880 | 1138 | 1160 | SM00355 | Zinc finger | |
IPR015880 | 1169 | 1192 | SM00355 | Zinc finger | |
IPR015880 | 1199 | 1222 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 78 | 105 | PS50157 | Zinc finger |
IPR007087 | 106 | 133 | PS50157 | Zinc finger | |
IPR007087 | 134 | 161 | PS50157 | Zinc finger | |
IPR007087 | 162 | 189 | PS50157 | Zinc finger | |
IPR007087 | 203 | 231 | PS50157 | Zinc finger | |
IPR007087 | 235 | 263 | PS50157 | Zinc finger | |
IPR007087 | 420 | 448 | PS50157 | Zinc finger | |
IPR007087 | 457 | 480 | PS50157 | Zinc finger | |
IPR007087 | 572 | 594 | PS50157 | Zinc finger | |
IPR007087 | 602 | 624 | PS50157 | Zinc finger | |
IPR007087 | 632 | 656 | PS50157 | Zinc finger | |
IPR007087 | 660 | 688 | PS50157 | Zinc finger | |
IPR007087 | 690 | 718 | PS50157 | Zinc finger | |
IPR007087 | 721 | 748 | PS50157 | Zinc finger | |
IPR007087 | 747 | 770 | PS50157 | Zinc finger | |
IPR007087 | 826 | 853 | PS50157 | Zinc finger | |
IPR007087 | 870 | 897 | PS50157 | Zinc finger | |
IPR007087 | 899 | 926 | PS50157 | Zinc finger | |
IPR007087 | 1060 | 1088 | PS50157 | Zinc finger | |
IPR007087 | 1108 | 1135 | PS50157 | Zinc finger | |
IPR007087 | 1138 | 1165 | PS50157 | Zinc finger | |
IPR007087 | 1169 | 1197 | PS50157 | Zinc finger | |
IPR007087 | 1199 | 1224 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 80 | 100 | PS00028 | Zinc finger |
IPR007087 | 108 | 128 | PS00028 | Zinc finger | |
IPR007087 | 136 | 156 | PS00028 | Zinc finger | |
IPR007087 | 164 | 184 | PS00028 | Zinc finger | |
IPR007087 | 205 | 226 | PS00028 | Zinc finger | |
IPR007087 | 237 | 258 | PS00028 | Zinc finger | |
IPR007087 | 265 | 285 | PS00028 | Zinc finger | |
IPR007087 | 383 | 404 | PS00028 | Zinc finger | |
IPR007087 | 422 | 443 | PS00028 | Zinc finger | |
IPR007087 | 459 | 480 | PS00028 | Zinc finger | |
IPR007087 | 574 | 594 | PS00028 | Zinc finger | |
IPR007087 | 604 | 624 | PS00028 | Zinc finger | |
IPR007087 | 634 | 655 | PS00028 | Zinc finger | |
IPR007087 | 662 | 683 | PS00028 | Zinc finger | |
IPR007087 | 692 | 713 | PS00028 | Zinc finger | |
IPR007087 | 723 | 743 | PS00028 | Zinc finger | |
IPR007087 | 749 | 770 | PS00028 | Zinc finger | |
IPR007087 | 828 | 849 | PS00028 | Zinc finger | |
IPR007087 | 872 | 892 | PS00028 | Zinc finger | |
IPR007087 | 901 | 921 | PS00028 | Zinc finger | |
IPR007087 | 930 | 950 | PS00028 | Zinc finger | |
IPR007087 | 962 | 982 | PS00028 | Zinc finger | |
IPR007087 | 1062 | 1083 | PS00028 | Zinc finger | |
IPR007087 | 1110 | 1130 | PS00028 | Zinc finger | |
IPR007087 | 1140 | 1160 | PS00028 | Zinc finger | |
IPR007087 | 1171 | 1192 | PS00028 | Zinc finger | |
IPR007087 | 1201 | 1222 | PS00028 | Zinc finger |
![]() |
Primer_f | TGCAACCCAGATGTAAAACTC |
---|---|
Primer_r | TGTAGTCTGCGGCGGAAAGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTAAGAACCCTGAGGCACCT |
Primer_r | TTGTGACTGCCCTTGATAAAC |
PCR product length | 206 bp |
PCR conditions | - |