Gene/Protein Characteristic Table for KIAA0760
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00627
Accession No AB018303
Description zinc finger protein 423, transcript variant 2
Clone name hk04642s1
Vector information
The cDNA fragment was originally inserted at SalI-NotI site ...
cDNA sequence DNA sequence (4248 bp)
Predicted protein sequence (1224 aa)
Flexi ORF Clone FXC00627
Source Human adult brain
Rouge ID mKIAA0760 by Kazusa Mouse cDNA Project
Note We replaced hk04642, former representative clones for KIAA0760 with hk04642s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 573 bp
Genome contig ID gi51511732r_47982115
PolyA signal sequence
(ATTAAA,-22)		 
+----*----+----*----+----*----+----
TCACCGGACAGTGATTAAAACTATGTAATGAATAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATCGGTTTCAGTGCAACTGGATGGTCTGCTTTTAAATGTGACTTAATCT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 r 48082115 48322279 6 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 1224 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q2M1K9 0 100.0 Zinc finger pro...
 Homo sapiens
XP_520629 0 99.9 zinc finger pro...
 Pan troglodytes
XP_001163978 0 99.9 zinc finger pro...
 Pan troglodytes
AAI48947 0 98.9 ZNF423 protein ...
 Bos taurus
XP_001476381 0 98.4 similar to earl...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB075834 8.9e-15 27.0 KIAA1954
AB107355 2e-12 26.5 KIAA2033
AB058730 5.9e-12 25.0 KIAA1827
AB033024 2.3e-11 25.9 KIAA1198
AB023189 2.4e-11 29.3 KIAA0972
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 134 157 PD000003 Zinc finger
HMMPfam IPR007087 78 100 PF00096 Zinc finger
IPR007087 106 128 PF00096 Zinc finger
IPR007087 134 156 PF00096 Zinc finger
IPR007087 162 184 PF00096 Zinc finger
IPR007087 203 226 PF00096 Zinc finger
IPR007087 349 373 PF00096 Zinc finger
IPR007087 381 404 PF00096 Zinc finger
IPR007087 420 443 PF00096 Zinc finger
IPR007087 572 594 PF00096 Zinc finger
IPR007087 602 624 PF00096 Zinc finger
IPR007087 632 655 PF00096 Zinc finger
IPR007087 660 683 PF00096 Zinc finger
IPR007087 690 713 PF00096 Zinc finger
IPR007087 721 743 PF00096 Zinc finger
IPR007087 826 849 PF00096 Zinc finger
IPR007087 870 892 PF00096 Zinc finger
IPR007087 899 921 PF00096 Zinc finger
IPR007087 1060 1083 PF00096 Zinc finger
IPR007087 1138 1160 PF00096 Zinc finger
IPR007087 1169 1192 PF00096 Zinc finger
IPR007087 1199 1222 PF00096 Zinc finger
HMMSmart IPR015880 7 28 SM00355 Zinc finger
IPR015880 78 100 SM00355 Zinc finger
IPR015880 106 128 SM00355 Zinc finger
IPR015880 134 156 SM00355 Zinc finger
IPR015880 162 184 SM00355 Zinc finger
IPR015880 203 226 SM00355 Zinc finger
IPR015880 235 258 SM00355 Zinc finger
IPR015880 263 285 SM00355 Zinc finger
IPR015880 349 373 SM00355 Zinc finger
IPR015880 381 404 SM00355 Zinc finger
IPR015880 420 443 SM00355 Zinc finger
IPR015880 457 480 SM00355 Zinc finger
IPR015880 503 528 SM00355 Zinc finger
IPR015880 572 594 SM00355 Zinc finger
IPR015880 602 624 SM00355 Zinc finger
IPR015880 632 655 SM00355 Zinc finger
IPR015880 660 683 SM00355 Zinc finger
IPR015880 690 713 SM00355 Zinc finger
IPR015880 721 743 SM00355 Zinc finger
IPR015880 747 770 SM00355 Zinc finger
IPR015880 826 849 SM00355 Zinc finger
IPR015880 870 892 SM00355 Zinc finger
IPR015880 899 921 SM00355 Zinc finger
IPR015880 928 950 SM00355 Zinc finger
IPR015880 960 982 SM00355 Zinc finger
IPR015880 1060 1083 SM00355 Zinc finger
IPR015880 1108 1130 SM00355 Zinc finger
IPR015880 1138 1160 SM00355 Zinc finger
IPR015880 1169 1192 SM00355 Zinc finger
IPR015880 1199 1222 SM00355 Zinc finger
ProfileScan IPR007087 78 105 PS50157 Zinc finger
IPR007087 106 133 PS50157 Zinc finger
IPR007087 134 161 PS50157 Zinc finger
IPR007087 162 189 PS50157 Zinc finger
IPR007087 203 231 PS50157 Zinc finger
IPR007087 235 263 PS50157 Zinc finger
IPR007087 420 448 PS50157 Zinc finger
IPR007087 457 480 PS50157 Zinc finger
IPR007087 572 594 PS50157 Zinc finger
IPR007087 602 624 PS50157 Zinc finger
IPR007087 632 656 PS50157 Zinc finger
IPR007087 660 688 PS50157 Zinc finger
IPR007087 690 718 PS50157 Zinc finger
IPR007087 721 748 PS50157 Zinc finger
IPR007087 747 770 PS50157 Zinc finger
IPR007087 826 853 PS50157 Zinc finger
IPR007087 870 897 PS50157 Zinc finger
IPR007087 899 926 PS50157 Zinc finger
IPR007087 1060 1088 PS50157 Zinc finger
IPR007087 1108 1135 PS50157 Zinc finger
IPR007087 1138 1165 PS50157 Zinc finger
IPR007087 1169 1197 PS50157 Zinc finger
IPR007087 1199 1224 PS50157 Zinc finger
ScanRegExp IPR007087 80 100 PS00028 Zinc finger
IPR007087 108 128 PS00028 Zinc finger
IPR007087 136 156 PS00028 Zinc finger
IPR007087 164 184 PS00028 Zinc finger
IPR007087 205 226 PS00028 Zinc finger
IPR007087 237 258 PS00028 Zinc finger
IPR007087 265 285 PS00028 Zinc finger
IPR007087 383 404 PS00028 Zinc finger
IPR007087 422 443 PS00028 Zinc finger
IPR007087 459 480 PS00028 Zinc finger
IPR007087 574 594 PS00028 Zinc finger
IPR007087 604 624 PS00028 Zinc finger
IPR007087 634 655 PS00028 Zinc finger
IPR007087 662 683 PS00028 Zinc finger
IPR007087 692 713 PS00028 Zinc finger
IPR007087 723 743 PS00028 Zinc finger
IPR007087 749 770 PS00028 Zinc finger
IPR007087 828 849 PS00028 Zinc finger
IPR007087 872 892 PS00028 Zinc finger
IPR007087 901 921 PS00028 Zinc finger
IPR007087 930 950 PS00028 Zinc finger
IPR007087 962 982 PS00028 Zinc finger
IPR007087 1062 1083 PS00028 Zinc finger
IPR007087 1110 1130 PS00028 Zinc finger
IPR007087 1140 1160 PS00028 Zinc finger
IPR007087 1171 1192 PS00028 Zinc finger
IPR007087 1201 1222 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGCAACCCAGATGTAAAACTC
Primer_r TGTAGTCTGCGGCGGAAAGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f CTTAAGAACCCTGAGGCACCT
Primer_r TTGTGACTGCCCTTGATAAAC
PCR product length 206 bp
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp