Order Kazusa clone(s) from : ![]() |
Product ID | ORK05564 |
---|---|
Accession No | AB018254 |
Description | kelch repeat and BTB (POZ) domain containing 11 |
Clone name | hg00358 |
Vector information | |
cDNA sequence | DNA sequence (6706 bp) Predicted protein sequence (661 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0711
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3871 bp |
---|---|
Genome contig ID | gi51511724f_1809451 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (133060 - 133109) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 1909451 | 1942509 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 171 | 269 | PF00651 | BTB/POZ |
IPR006652 | 386 | 437 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 439 | 480 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 484 | 525 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR000210 | 178 | 269 | SM00225 | BTB/POZ-like |
IPR006652 | 398 | 450 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 451 | 495 | SM00612 | Kelch repeat type 1 | |
IPR006652 | 496 | 538 | SM00612 | Kelch repeat type 1 | |
ProfileScan | IPR000210 | 178 | 234 | PS50097 | BTB/POZ-like |
![]() |
Primer_f | TCCTCCAAAGCCTGTTCAAGC |
---|---|
Primer_r | GAACTGACAAACATACGAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCTCCAAAGCCTGTTCAAGC |
Primer_r | GAACTGACAAACATACGAGGC |
PCR product length | 185 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |