Order Kazusa clone(s) from : ![]() |
Product ID | ORK06218 |
---|---|
Accession No | AB014557 |
Description | obscurin-like 1 |
Clone name | hk01859s1 |
Vector information | |
cDNA sequence | DNA sequence (5382 bp) Predicted protein sequence (1237 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0657
by Kazusa Mouse cDNA Project
|
Note | We replaced hk01859, former representative clones for KIAA0657 with hk01859s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 1667 bp |
---|---|
Genome contig ID | gi89161199r_220023695 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 220123695 | 220143707 | 16 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013098 | 30 | 62 | PF07679 | Immunoglobulin I-set |
IPR013098 | 87 | 172 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 177 | 262 | PF07679 | Immunoglobulin I-set | |
IPR003961 | 351 | 437 | PF00041 | Fibronectin | |
IPR013151 | 567 | 626 | PF00047 | Immunoglobulin | |
IPR013151 | 658 | 717 | PF00047 | Immunoglobulin | |
IPR013151 | 749 | 808 | PF00047 | Immunoglobulin | |
IPR013151 | 840 | 899 | PF00047 | Immunoglobulin | |
IPR013151 | 932 | 991 | PF00047 | Immunoglobulin | |
IPR013098 | 1044 | 1087 | PF07679 | Immunoglobulin I-set | |
IPR013151 | 1118 | 1151 | PF00047 | Immunoglobulin | |
HMMSmart | IPR003599 | 2 | 63 | SM00409 | Immunoglobulin subtype |
IPR003599 | 88 | 173 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 94 | 162 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 183 | 263 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 189 | 255 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 271 | 347 | SM00409 | Immunoglobulin subtype | |
IPR003599 | 458 | 547 | SM00409 | Immunoglobulin subtype | |
IPR003599 | 559 | 640 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 565 | 631 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 650 | 729 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 656 | 722 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 741 | 820 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 747 | 813 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 832 | 911 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 838 | 904 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 924 | 1007 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 930 | 996 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 1020 | 1099 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1026 | 1092 | SM00408 | Immunoglobulin subtype 2 | |
ProfileScan | IPR007110 | 79 | 166 | PS50835 | Immunoglobulin-like |
IPR007110 | 175 | 261 | PS50835 | Immunoglobulin-like | |
IPR003961 | 353 | 446 | PS50853 | Fibronectin | |
IPR007110 | 550 | 636 | PS50835 | Immunoglobulin-like | |
IPR007110 | 640 | 729 | PS50835 | Immunoglobulin-like | |
IPR007110 | 738 | 818 | PS50835 | Immunoglobulin-like | |
IPR007110 | 822 | 911 | PS50835 | Immunoglobulin-like | |
IPR007110 | 913 | 1005 | PS50835 | Immunoglobulin-like | |
IPR007110 | 1009 | 1087 | PS50835 | Immunoglobulin-like | |
IPR007110 | 1101 | 1140 | PS50835 | Immunoglobulin-like |
![]() |
---|
Primer_f | GCTCTTTGTGTACTGGTGTCC |
---|---|
Primer_r | GCAAACGCCTTCCAAGCTGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCTCTTTGTGTACTGGTGTCC |
Primer_r | GCAAACGCCTTCCAAGCTGTC |
PCR product length | 154 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |