Order Kazusa clone(s) from : ![]() |
Product ID | ORK06729 |
---|---|
Accession No | AB011096 |
Description | sterile alpha and TIR motif containing 1 |
Clone name | hg01923 |
Vector information | |
cDNA sequence | DNA sequence (6559 bp) Predicted protein sequence (598 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0524
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4761 bp |
---|---|
Genome contig ID | gi51511734f_23623556 |
PolyA signal sequence (CATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (128638 - 128687) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 23723556 | 23752192 | 9 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011510 | 283 | 350 | PF07647 | Sterile alpha motif homology 2 |
IPR011510 | 353 | 422 | PF07647 | Sterile alpha motif homology 2 | |
HMMSmart | IPR001660 | 283 | 350 | SM00454 | Sterile alpha motif SAM |
IPR001660 | 353 | 422 | SM00454 | Sterile alpha motif SAM | |
IPR000157 | 435 | 576 | SM00255 | Toll-Interleukin receptor | |
ProfileScan | IPR001660 | 286 | 350 | PS50105 | Sterile alpha motif SAM |
IPR001660 | 360 | 422 | PS50105 | Sterile alpha motif SAM |
![]() |
---|
Primer_f | GCAGCCATTTGTTTAGTAGCC |
---|---|
Primer_r | TCACTTAACCTATGTCTCCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAGCCATTTGTTTAGTAGCC |
Primer_r | TCACTTAACCTATGTCTCCCC |
PCR product length | 125 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |