Order Kazusa clone(s) from : ![]() |
Product ID | ORK00090 |
---|---|
Accession No | AB011084 |
Description | armadillo repeat containing, X-linked 2, transcript variant 2 |
Clone name | hf00239 |
Vector information | |
cDNA sequence | DNA sequence (2620 bp) Predicted protein sequence (710 aa) |
HaloTag ORF Clone |
FHC00090
![]() |
Flexi ORF Clone | FXC00090 |
Source | Human adult brain |
Rouge ID |
mKIAA0512
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006911 | 443 | 704 | PF04826 | Protein of unknown function DUF634 |
HMMSmart | IPR000225 | 494 | 535 | SM00185 | Armadillo |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 83 | RDAGCVAAGIVIGAGAWYCVYKY | 105 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | CGTGCGTTTAACCCAGGCGAG |
---|---|
Primer_r | CTGCTGGCCTTCTATGCGCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CGTGCGTTTAACCCAGGCGAG |
Primer_r | CTGCTGGCCTTCTATGCGCTG |
PCR product length | 136 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |