Order Kazusa clone(s) from : ![]() |
Product ID | ORK00890 |
---|---|
Accession No | AB051488 |
Description | basic helix-loop-helix domain containing, class B, 9, transcript variant 2 |
Clone name | fj15383 |
Vector information | |
cDNA sequence | DNA sequence (3827 bp) Predicted protein sequence (570 aa) |
HaloTag ORF Clone |
FHC00890
![]() |
Flexi ORF Clone | FXC00890 |
Source | Human fetal brain |
Rouge ID |
mKIAA1701
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1800 bp |
---|---|
Genome contig ID | gi89161218f_101789410 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (104614 - 104663) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGCATTCCCAGGACATTTAGG |
---|---|
Primer_r | TATACAGTGGGGGGAAGCAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |