Order Kazusa clone(s) from : ![]() |
Product ID | ORK00548 |
---|---|
Accession No | AB088477 |
Description | period circadian clock 1 |
Clone name | hj01880 |
Vector information | |
cDNA sequence | DNA sequence (4649 bp) Predicted protein sequence (1332 aa) |
HaloTag ORF Clone |
FHC00548
![]() |
Flexi ORF Clone | FXC00548 |
Source | Human adult brain |
Rouge ID |
mKIAA0482
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 596 bp |
---|---|
Genome contig ID | gi51511734r_7884515 |
PolyA signal sequence (GATAAA,-12) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 7984515 | 7996420 | 23 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GAACTCAGATGTGGCTAGACC |
Primer_r | TGTCAGCAACTTTGTCCAGGG |
PCR product length | 209 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |