|
Order Kazusa clone(s) from : |
| Product ID | ORK06744 |
|---|---|
| Accession No | AB007937 |
| Description | syndecan 3 |
| Clone name | hg01596 |
| Vector information | |
| cDNA sequence | DNA sequence (6400 bp) Predicted protein sequence (410 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0468
by Kazusa Mouse cDNA Project
|
Length: 6400 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 3742 bp |
|---|---|
| Genome contig ID | gi89161185r_31014901 |
| PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | r | 31114901 | 31124176 | 3 | 99.0 | Terminal No-hit |
Length: 410 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001050 | 19 | 408 | PF01034 | Syndecan |
| HMMSmart | IPR003585 | 376 | 394 | SM00294 | Neurexin/syndecan/glycophorin C |
| ScanRegExp | IPR001050 | 377 | 387 | PS00964 | Syndecan |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 19 | RGLGDLILMAIAYLGSSCP | 37 | SECONDARY | 19 | 2 | 352 | EVLVAVIVGGVVGALFAAFLVTL | 374 | PRIMARY | 23 |
|---|
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GGGCTCTGGGGATGATGACTC |
| Primer_r | CCCGTGGGCTTCTCAGAGTTG |
| PCR product length | 149 bp |
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |