Order Kazusa clone(s) from : ![]() |
Product ID | ORK04505 |
---|---|
Accession No | AB007920 |
Description | CDC42 binding protein kinase alpha (DMPK-like) |
Clone name | pf06424 |
Vector information | |
cDNA sequence | DNA sequence (7335 bp) Predicted protein sequence (983 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA0451
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00286, former representative clones for KIAA0451 with pf06424. (2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4382 bp |
---|---|
Genome contig ID | gi89161185r_225144190 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 225244190 | 225335303 | 22 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002219 | 199 | 213 | PR00008 | Protein kinase C |
IPR002219 | 215 | 224 | PR00008 | Protein kinase C | |
IPR002219 | 228 | 239 | PR00008 | Protein kinase C | |
IPR002219 | 240 | 252 | PR00008 | Protein kinase C | |
HMMPfam | IPR014930 | 83 | 143 | PF08826 | DMPK coiled coil |
IPR002219 | 202 | 254 | PF00130 | Protein kinase C | |
IPR001849 | 272 | 390 | PF00169 | Pleckstrin-like | |
IPR001180 | 417 | 688 | PF00780 | Citron-like | |
HMMSmart | IPR002219 | 202 | 251 | SM00109 | Protein kinase C |
IPR001849 | 272 | 392 | SM00233 | Pleckstrin-like | |
IPR001180 | 417 | 699 | SM00036 | Citron-like | |
IPR000095 | 760 | 795 | SM00285 | PAK-box/P21-Rho-binding | |
IPR000095 | 801 | 838 | SM00285 | PAK-box/P21-Rho-binding | |
ProfileScan | IPR002219 | 201 | 251 | PS50081 | Protein kinase C |
IPR001849 | 271 | 390 | PS50003 | Pleckstrin-like | |
IPR000095 | 760 | 773 | PS50108 | PAK-box/P21-Rho-binding | |
IPR000095 | 801 | 814 | PS50108 | PAK-box/P21-Rho-binding | |
ScanRegExp | IPR002219 | 202 | 251 | PS00479 | Protein kinase C |
IPR001304 | 218 | 239 | PS00615 | C-type lectin |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATTGGTGAGGAGTCTTTTGTG |
Primer_r | TTTATGCCCTCAGTGTCTTAG |
PCR product length | 128 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |