KIAA0430

Product ID	ORK05840
Accession No	AB007890
Description	KIAA0430
Clone name	hg02974
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6827 bp) Predicted protein sequence (1506 aa)
Source	Human adult brain
Rouge ID	mKIAA0430 by Kazusa Mouse cDNA Project
Note	We replaced hh01734, former representative clones for KIAA0430 with hg02974. (2005/08/06)

Length: 6827 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2305 bp
Genome contig ID	gi51511732r_15495746
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAACAGTTGTCAATAAACTTTACAAGCGAGCATCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTGAGTTTCCCAAGTGAGTGGTTTTGTCTGTCTGTCTGTCTGTGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	15595746	15637137	25	100.0	Perfect prediction

Length: 1506 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511188	99.9	limkain b1 isof...	Pan troglodytes
XP_001149081	99.9	limkain b1 isof...	Pan troglodytes
Q9Y4F3	99.9	Limkain-b1.	Homo sapiens
XP_001108854	98.6	similar to limk...	Macaca mulatta
XP_001108939	98.6	similar to limk...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007491	115	259	PF04396	Protein of unknown function DUF537
HMMSmart	IPR000504	277	345	SM00360	RNA recognition motif
HMMSmart	IPR000504	556	630	SM00360	RNA recognition motif
ProfileScan	IPR000504	555	634	PS50102	RNA recognition motif

Primer_f	TCCCAACACACAAAACAGCAC
Primer_r	CACTGTTTGTTTTGGATTGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCCAACACACAAAACAGCAC
Primer_r	CACTGTTTGTTTTGGATTGGG
PCR product length	106 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles