KIAA0421

Product ID	ORK06907
Accession No	AB007881
Description	SMG1 phosphatidylinositol 3-kinase-related kinase
Clone name	hh01158s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh01158s1 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCA CGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (7775 bp) Predicted protein sequence (1988 aa)
Source	Human adult brain
Rouge ID	mKIAA0421 by Kazusa Mouse cDNA Project
Note	We replaced hh01158, former representative clones for KIAA0421 with hh01158s1. (2002/5/10)

Length: 7775 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1808 bp
Genome contig ID	gi51511732r_18626884
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- GAGCTAGACTCTGTGTCAAAAATAAATGACTAGAT
Flanking genome sequence (99699 - 99650)	----+--------+--------+--------+--------+----* AAAAAAAAAAATTGTTTGAGTACATTTTCCCTGCATTTTAGAGATTAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	18726583	18770922	31	99.7	Perfect prediction

Length: 1988 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK00511	100.0	PI-3-kinase-rel...	Homo sapiens
AAM73708	100.0	PI-3-kinase ATX...	Homo sapiens
EAW50263	100.0	hCG1994151, iso...	Homo sapiens
EAW50260	100.0	hCG1994151, iso...	Homo sapiens
EAW50261	100.0	hCG1994151, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002371	0.00015	20.5	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	144	179	PF02985	HEAT
	IPR000403	476	754	PF00454	Phosphatidylinositol 3- and 4-kinase
	IPR003152	1956	1988	PF02260	PIK-related kinase
HMMSmart	IPR000403	478	809	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR014009	1	193	PS51189	PIK-related kinase
	IPR000403	477	805	PS50290	Phosphatidylinositol 3- and 4-kinase
	IPR003152	1956	1988	PS51190	PIK-related kinase
ScanRegExp	IPR000403	647	667	PS00916	Phosphatidylinositol 3- and 4-kinase

Primer_f	GGGTTTTTATTTTGGATCAGC
Primer_r	AGTTATTAGTCTGTGAAGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGTTTTTATTTTGGATCAGC
Primer_r	AGTTATTAGTCTGTGAAGTGC
PCR product length	111 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles