Order Kazusa clone(s) from : ![]() |
Product ID | ORK00059 |
---|---|
Accession No | AB002356 |
Description | MAP-kinase activating death domain, transcript variant 7 |
Clone name | hh00017 |
Vector information | |
cDNA sequence | DNA sequence (5942 bp) Predicted protein sequence (1584 aa) |
HaloTag ORF Clone |
FHC00059
![]() |
Flexi ORF Clone | FXC00059 |
Source | Human adult brain |
Rouge ID |
mKIAA0358
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005113 | 11 | 101 | PF03456 | uDENN |
IPR001194 | 175 | 405 | PF02141 | DENN | |
IPR005112 | 488 | 561 | PF03455 | dDENN | |
HMMSmart | IPR005113 | 11 | 101 | SM00800 | uDENN |
IPR001194 | 175 | 405 | SM00799 | DENN | |
IPR005112 | 488 | 558 | SM00801 | dDENN | |
ProfileScan | IPR005113 | 11 | 107 | PS50946 | uDENN |
IPR001194 | 175 | 405 | PS50211 | DENN | |
IPR005112 | 488 | 561 | PS50947 | dDENN |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 303 | PLELLGVDACLQVLTCILLEHKV | 325 | PRIMARY | 23 | 2 | 336 | SMSVMAFVAMIYPLEYMFPVIPL | 358 | PRIMARY | 23 | 3 | 369 | LLLAPTPYIIGVPASFFLYKLDF | 391 | SECONDARY | 23 |
---|
![]() |
---|
Primer_f | GAATGCTGACTCCTTGCTTGG |
---|---|
Primer_r | TCAAGTAACCGAGGACAGAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GAATGCTGACTCCTTGCTTGG |
Primer_r | TCAAGTAACCGAGGACAGAAC |
PCR product length | 100 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |