Order Kazusa clone(s) from : ![]() |
Product ID | ORK00504 |
---|---|
Accession No | AB002317 |
Description | KIAA0319, transcript variant 1 |
Clone name | hg00378 |
Vector information | |
cDNA sequence | DNA sequence (6791 bp) Predicted protein sequence (1109 aa) |
HaloTag ORF Clone |
FHC00504
![]() |
Flexi ORF Clone | FXC00504 |
Source | Human adult brain |
Rouge ID |
mKIAA0319
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3061 bp |
---|---|
Genome contig ID | gi89161210r_24552469 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99842 - 99793) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 24652311 | 24754362 | 21 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR011106 | 57 | 139 | SM00765 | Seven cysteines |
IPR003961 | 342 | 455 | SM00060 | Fibronectin | |
IPR000601 | 378 | 464 | SM00089 | PKD | |
IPR003961 | 471 | 549 | SM00060 | Fibronectin | |
IPR000601 | 472 | 561 | SM00089 | PKD | |
IPR000601 | 567 | 657 | SM00089 | PKD | |
IPR003961 | 630 | 739 | SM00060 | Fibronectin | |
IPR000601 | 658 | 751 | SM00089 | PKD | |
IPR003961 | 756 | 836 | SM00060 | Fibronectin | |
IPR000601 | 757 | 848 | SM00089 | PKD | |
ProfileScan | IPR013980 | 50 | 136 | PS50986 | Seven cysteines |
IPR000601 | 582 | 655 | PS50093 | PKD |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 37 | TMAPPTGVLSSLLLLVTIAGCA | 58 | PRIMARY | 22 | 2 | 994 | FYVTVLAFTLIVLTGGFTWLCIC | 1016 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | AGACCCACTTTTCGGCTCATG |
---|---|
Primer_r | TTTATGCTTCAGGGTAGAGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGACCCACTTTTCGGCTCATG |
Primer_r | TTTATGCTTCAGGGTAGAGGG |
PCR product length | 97 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |