Order Kazusa clone(s) from : ![]() |
Product ID | ORK00049 |
---|---|
Accession No | AB002309 |
Description | A kinase (PRKA) anchor protein 6 |
Clone name | hg00112s1 |
Vector information | |
cDNA sequence | DNA sequence (10327 bp) Predicted protein sequence (2324 aa) |
HaloTag ORF Clone |
FHC00049
![]() |
Flexi ORF Clone | FXC00049 |
Source | Human adult brain |
Rouge ID |
mKIAA0311
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00112, former representative clones for KIAA0311 with hg00112s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3257 bp |
---|---|
Genome contig ID | gi51511730f_31768290 |
PolyA signal sequence (AATAAA,-15) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (603730 - 603779) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 31868290 | 32372018 | 14 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | TCAGTCAGGTTGGAATGGATC |
---|---|
Primer_r | CTCTTTCTCATGGCAACCCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCAGTCAGGTTGGAATGGATC |
Primer_r | CTCTTTCTCATGGCAACCCTG |
PCR product length | 118 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |