KIAA0155

Product ID	ORK00434
Accession No	D63875
Description	CTR9 homolog, Paf1/RNA polymerase II complex component
Clone name	ha02997
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4243 bp) Predicted protein sequence (1195 aa)
HaloTag ORF Clone	FHC00434
Flexi ORF Clone	FXC00434
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0155 by Kazusa Mouse cDNA Project

Length: 4243 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	635 bp
Genome contig ID	gi51511727f_10629450
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CTACCTAAGCCACATAATAATAAAATTCTTTTACC
Flanking genome sequence (128415 - 128464)	----+--------+--------+--------+--------+----* AACTTTTATGGGTAACTTCGTGTCTTTTTTTGTTCGATATATTTGTGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	10729450	10757863	25	100.0	Perfect prediction

Length: 1195 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6PD62	100.0	RNA polymerase-...	Homo sapiens
BAF84483	99.9	unnamed protein...	Homo sapiens
XP_521841	99.9	SH2 domain bind...	Pan troglodytes
XP_534056	98.5	similar to SH2 ...	Canis lupus fam...
XP_001094093	99.6	similar to SH2 ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	185	218	PF00515	Tetratricopeptide TPR_1
	IPR001440	220	253	PF00515	Tetratricopeptide TPR_1
	IPR001440	328	361	PF00515	Tetratricopeptide TPR_1
	IPR013105	363	396	PF07719	Tetratricopeptide TPR_2
	IPR013105	473	506	PF07719	Tetratricopeptide TPR_2
	IPR013105	519	552	PF07719	Tetratricopeptide TPR_2
	IPR001440	553	586	PF00515	Tetratricopeptide TPR_1
	IPR001440	703	736	PF00515	Tetratricopeptide TPR_1
	IPR001440	739	772	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	185	218	SM00028	Tetratricopeptide region
	IPR013026	220	253	SM00028	Tetratricopeptide region
	IPR013026	328	361	SM00028	Tetratricopeptide region
	IPR013026	363	396	SM00028	Tetratricopeptide region
	IPR013026	473	506	SM00028	Tetratricopeptide region
	IPR013026	519	552	SM00028	Tetratricopeptide region
	IPR013026	553	586	SM00028	Tetratricopeptide region
	IPR013026	587	620	SM00028	Tetratricopeptide region
	IPR013026	703	736	SM00028	Tetratricopeptide region
	IPR013026	739	772	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	151	772	PS50293	Tetratricopeptide region
	IPR013026	185	218	PS50005	Tetratricopeptide region
	IPR013026	220	253	PS50005	Tetratricopeptide region
	IPR013026	328	361	PS50005	Tetratricopeptide region
	IPR013026	363	396	PS50005	Tetratricopeptide region
	IPR013026	473	506	PS50005	Tetratricopeptide region
	IPR013026	519	552	PS50005	Tetratricopeptide region
	IPR013026	553	586	PS50005	Tetratricopeptide region
	IPR013026	587	620	PS50005	Tetratricopeptide region
	IPR013026	703	736	PS50005	Tetratricopeptide region
	IPR013026	739	772	PS50005	Tetratricopeptide region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TCACTCACCTCTGGATTAGCC
Primer_r	TCTCCCTCCGGTAACTGATCG
PCR product length	168 (1.5k) bp
PCR conditions	95 °C15 sec64 °C180 sec30 cycles