KIAA0928

Product ID	ORK04772
Accession No	AB023145
Description	dicer 1, ribonuclease type III, transcript variant 2
Clone name	hh16052
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6037 bp) Predicted protein sequence (1922 aa)
Source	Human adult brain
Rouge ID	mKIAA0928 by Kazusa Mouse cDNA Project
Note	We replaced hh03019, former representative clones for KIAA0928 with hh16052. (2002/5/10)

Length: 6037 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	30 bp
Genome contig ID	gi51511730r_94526558
PolyA signal sequence (AAGAAA,-7)	+--------+--------+----*----+---- GCTGAAACCGCTTTTTAAAATTCAAAACAAGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACAAAAAAAATTAAGGGGAAAATTATTTAAATCGGAAAGGAAGACTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	94626558	94693512	27	100.0	Perfect prediction

Length: 1922 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001154199	99.9	dicer1 isoform ...	Pan troglodytes
EAW81595	99.8	Dicer1, Dcr-1 h...	Homo sapiens
XP_001154010	99.8	dicer1 isoform ...	Pan troglodytes
Q9UPY3	100.0	Endoribonucleas...	Homo sapiens
XP_001100868	99.4	similar to dice...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	45	207	PF00270	DNA/RNA helicase
	IPR001650	499	556	PF00271	DNA/RNA helicase
	IPR005034	630	722	PF03368	Protein of unknown function DUF283
	IPR003100	891	1065	PF02170	Argonaute and Dicer protein
	IPR000999	1313	1575	PF00636	Ribonuclease III
	IPR000999	1702	1824	PF00636	Ribonuclease III
	IPR001159	1853	1912	PF00035	Double-stranded RNA binding
HMMSmart	IPR014001	40	249	SM00487	DEAD-like helicases
	IPR001650	459	556	SM00490	DNA/RNA helicase
	IPR000999	1295	1596	SM00535	Ribonuclease III
	IPR000999	1681	1847	SM00535	Ribonuclease III
	IPR001159	1850	1913	SM00358	Double-stranded RNA binding
ProfileScan	IPR014021	51	227	PS51192	Helicase
	IPR001650	433	602	PS51194	DNA/RNA helicase
	IPR003100	891	1042	PS50821	Argonaute and Dicer protein
	IPR000999	1283	1372	PS50142	Ribonuclease III
	IPR000999	1666	1824	PS50142	Ribonuclease III
	IPR001159	1849	1914	PS50137	Double-stranded RNA binding
ScanRegExp	IPR000999	1702	1710	PS00517	Ribonuclease III

Primer_f	GCACCTTTACCCTTAGTCTCC
Primer_r	AACTTTCACGGCATTAACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCACCTTTACCCTTAGTCTCC
Primer_r	AACTTTCACGGCATTAACAGC
PCR product length	105 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles