KIAA0012

Product ID	ORK01951
Accession No	D13637
Description	toll-like receptor 1
Clone name	ha00413
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2621 bp) Predicted protein sequence (789 aa)
HaloTag ORF Clone	FHC01951
Flexi ORF Clone	FXC01951
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0012 by Kazusa Mouse cDNA Project

Length: 2621 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	197 bp
Genome contig ID	gi89161207r_38374290
PolyA signal sequence (ATTAAA,-34)	+--------+--------+----*----+---- TATTAAAAATTAATGAAATGATATAACTTTGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACAGTTCTGACACATAAGGGATCCACTTGTTTCTTTGCTATAACTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	38474290	38476910	1	99.0	Perfect prediction

Length: 789 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72826	100.0	toll-like recep...	synthetic construct
Q15399	99.9	Toll-like recep...	Homo sapiens
AAC34137	99.6	Toll-like recep...	Homo sapiens
BAF85671	99.6	unnamed protein...	Homo sapiens
AAH89403	99.5	Toll-like recep...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020669	1.3e-05	26.0	KIAA0862
AB040930	0.00014	29.5	KIAA1497
AB011537	0.0003	24.1	KIAA0813
AB037858	0.0004	21.4	KIAA1437
AB011538	0.001	21.3	KIAA0814

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	98	111	PR00019	Leucine-rich repeat
	IPR001611	400	413	PR00019	Leucine-rich repeat
	IPR004075	675	702	PR01537	Interleukin-1 receptor
	IPR004075	713	738	PR01537	Interleukin-1 receptor
	IPR004075	764	783	PR01537	Interleukin-1 receptor
HMMPfam	IPR001611	73	95	PF00560	Leucine-rich repeat
	IPR001611	97	115	PF00560	Leucine-rich repeat
	IPR001611	118	138	PF00560	Leucine-rich repeat
	IPR001611	449	470	PF00560	Leucine-rich repeat
	IPR001611	472	492	PF00560	Leucine-rich repeat
	IPR001611	494	516	PF00560	Leucine-rich repeat
	IPR000483	556	581	PF01463	Cysteine-rich flanking region
	IPR000157	642	778	PF01582	Toll-Interleukin receptor
HMMSmart	IPR003591	71	94	SM00369	Leucine-rich repeat
	IPR003591	116	140	SM00369	Leucine-rich repeat
	NULL	374	393	SM00364	NULL
	IPR003591	374	397	SM00369	Leucine-rich repeat
	NULL	447	466	SM00364	NULL
	NULL	470	489	SM00364	NULL
	IPR003591	470	494	SM00369	Leucine-rich repeat
	IPR000483	527	581	SM00082	Cysteine-rich flanking region
	IPR000157	639	782	SM00255	Toll-Interleukin receptor
ProfileScan	IPR000157	638	782	PS50104	Toll-Interleukin receptor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	IFHFAIIFMLILQIRIQLSEESE	29	SECONDARY	23
SOSUI2	2	580	CNITLLIVTIVATMLVLAVTVTS	602	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGCCCATCACAATCTCTTTC
Primer_r	TATTTCTTTGCTTGCTCTGT
PCR product length	222 bp
PCR conditions	95 °C15 sec58 °C60 sec30 cycles