KIAA1497

Product ID	ORK05885
Accession No	AB040930
Description	leucine rich repeat neuronal 1
Clone name	hg01608
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6250 bp) Predicted protein sequence (730 aa)
Source	Human adult brain
Rouge ID	mKIAA1497 by Kazusa Mouse cDNA Project

Length: 6250 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	833 bp
Genome contig ID	gi89161205f_3758125
PolyA signal sequence (None)	+--------+--------+----*----+---- AAATTAGTTTTGTTCTGATTTTTTAGAACACTTGC
Flanking genome sequence (106188 - 106237)	----+--------+--------+--------+--------+----* AATAATGTATCATTTATAGTTCTTGCTAGTTGCAGTGGTAATATTTTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	3857911	3864311	2	99.0	Perfect prediction

Length: 730 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6UXK5	100.0	Leucine-rich re...	Homo sapiens
AAH34947	99.9	Leucine rich re...	Homo sapiens
BAF84406	99.9	unnamed protein...	Homo sapiens
XP_526119	99.7	leucine rich re...	Pan troglodytes
XP_001099632	99.0	leucine rich re...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007865	1.9e-13	24.0	KIAA0405
AB007876	5.8e-12	29.1	KIAA0416
AB011537	8e-11	26.3	KIAA0813
AB014544	2.8e-10	26.9	KIAA0644
AB011538	2.1e-09	24.4	KIAA0814

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	111	124	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	180	193	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	110	132	PF00560	Leucine-rich repeat
	IPR001611	134	156	PF00560	Leucine-rich repeat
	IPR001611	158	180	PF00560	Leucine-rich repeat
	IPR001611	230	252	PF00560	Leucine-rich repeat
	IPR001611	254	276	PF00560	Leucine-rich repeat
	IPR001611	278	300	PF00560	Leucine-rich repeat
	IPR000483	410	437	PF01463	Cysteine-rich flanking region
	IPR013098	438	530	PF07679	Immunoglobulin I-set
	IPR003961	537	619	PF00041	Fibronectin
HMMSmart	NULL	108	129	SM00365	NULL
	IPR003591	108	131	SM00369	Leucine-rich repeat
	IPR003591	132	155	SM00369	Leucine-rich repeat
	IPR003591	156	179	SM00369	Leucine-rich repeat
	NULL	156	182	SM00365	NULL
	IPR003591	180	203	SM00369	Leucine-rich repeat
	IPR003591	228	251	SM00369	Leucine-rich repeat
	IPR003591	252	275	SM00369	Leucine-rich repeat
	NULL	252	273	SM00365	NULL
	NULL	276	297	SM00365	NULL
	IPR003591	276	299	SM00369	Leucine-rich repeat
	IPR003591	325	349	SM00369	Leucine-rich repeat
	IPR003591	350	373	SM00369	Leucine-rich repeat
	IPR000483	385	437	SM00082	Cysteine-rich flanking region
	IPR003599	446	531	SM00409	Immunoglobulin subtype
	IPR003598	452	520	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	438	529	PS50835	Immunoglobulin-like
ProfileScan	IPR003961	536	628	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	ARMSFVIAACQLVLGLLMTSLTE	38	SECONDARY	23
SOSUI2	2	644	TALAAVMGSMFAVISLASIAVYF	666	PRIMARY	23

Primer_f	TGCAGCCTTCCACAGATTATG
Primer_r	AAAGTACACAGCAATGGACGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACATACGGTTTTGAAGCAGCC
Primer_r	CATTCAACGAGGTAACAAGTC
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec35 cycles