Order Kazusa clone(s) from : ![]() |
Product ID | ORK05078 |
---|---|
Accession No | AK024499 |
Clone name | as00108 |
Vector information | |
cDNA sequence | DNA sequence (4292 bp) Predicted protein sequence (216 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00108
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GTGTCCGAGGTTGCTATGGTG |
---|---|
Primer_r | GAACTGGACCAAGCAAAGGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |