Gene/Protein Characteristic Table for FLJ00070

Description

Product ID:	ORK01033
Accession No.:	AK024477
Alias Name:
Clone Name:	as00070 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4439
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 261 bp

Genome contig ID gi29824582r_65456434
PolyA signal sequence
(GATAAA,-23)
+----*----+----*----+----*----+----
TTCCTAGAAACTGATAAATCAGATCGTGCCTCTTT
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 1382

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB15767	100.0	FLJ00070 protei...	Homo sapiens
BAG10271	100.0	latent-transfor...	synthetic construct
Q9NS15	99.9	Latent-transfor...	Homo sapiens
EAW74405	100.0	latent transfor...	Homo sapiens
AAF62352	96.3	latent transfor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB053450	1.7e-19	29.5	KIAA1776
AB011539	8.4e-13	29.9	KIAA0815
AK074062	1.2e-05	30.3	FLJ00133
AB058677	5.7e-05	26.7	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001438 695 706 PR00010 Type II EGF-like signature

IPR001438 818 825 PR00010 Type II EGF-like signature

IPR001438 967 977 PR00010 Type II EGF-like signature

HMMPfam IPR006209 192 219 PF00008 EGF-like domain

IPR002212 366 409 PF00683 Matrix fibril-associated

NULL 434 473 PF07645 NULL

IPR002212 492 533 PF00683 Matrix fibril-associated

NULL 695 737 PF07645 NULL

NULL 739 771 PF07645 NULL

NULL 782 821 PF07645 NULL

NULL 823 862 PF07645 NULL

NULL 864 903 PF07645 NULL

IPR006209 868 903 PF00008 EGF-like domain

NULL 905 943 PF07645 NULL

NULL 945 986 PF07645 NULL

IPR006209 949 986 PF00008 EGF-like domain

IPR002212 1006 1049 PF00683 Matrix fibril-associated

NULL 1072 1113 PF07645 NULL

NULL 1115 1154 PF07645 NULL

IPR006209 1119 1154 PF00008 EGF-like domain

NULL 1161 1200 PF07645 NULL

IPR002212 1225 1270 PF00683 Matrix fibril-associated

NULL 1333 1376 PF07645 NULL

HMMSmart IPR006210 191 220 SM00181 Type I EGF

IPR001881 192 220 SM00179 EGF-like calcium-binding

IPR001881 434 474 SM00179 EGF-like calcium-binding

IPR006210 437 474 SM00181 Type I EGF

IPR001881 653 694 SM00179 EGF-like calcium-binding

IPR006210 656 694 SM00181 Type I EGF

IPR001881 695 738 SM00179 EGF-like calcium-binding

IPR006210 698 738 SM00181 Type I EGF

IPR001881 739 781 SM00179 EGF-like calcium-binding

IPR006210 742 781 SM00181 Type I EGF

IPR001881 782 822 SM00179 EGF-like calcium-binding

IPR006210 785 822 SM00181 Type I EGF

IPR001881 823 863 SM00179 EGF-like calcium-binding

IPR006210 826 863 SM00181 Type I EGF

IPR001881 864 904 SM00179 EGF-like calcium-binding

IPR006210 867 904 SM00181 Type I EGF

IPR001881 905 944 SM00179 EGF-like calcium-binding

IPR006210 908 944 SM00181 Type I EGF

IPR001881 945 987 SM00179 EGF-like calcium-binding

IPR006210 948 987 SM00181 Type I EGF

IPR001881 1072 1114 SM00179 EGF-like calcium-binding

IPR006210 1075 1114 SM00181 Type I EGF

IPR001881 1115 1155 SM00179 EGF-like calcium-binding

IPR006210 1118 1155 SM00181 Type I EGF

IPR001881 1161 1201 SM00179 EGF-like calcium-binding

IPR006210 1164 1201 SM00181 Type I EGF

IPR001881 1296 1332 SM00179 EGF-like calcium-binding

IPR006210 1299 1332 SM00181 Type I EGF

IPR001881 1333 1377 SM00179 EGF-like calcium-binding

IPR006210 1336 1377 SM00181 Type I EGF

ProfileScan IPR000694 25 84 PS50099 Proline-rich region

NULL 83 246 PS50315 NULL

NULL 434 474 PS50034 NULL

NULL 653 694 PS50034 NULL

NULL 657 973 PS50311 NULL

NULL 695 738 PS50034 NULL

NULL 739 781 PS50034 NULL

NULL 782 822 PS50034 NULL

NULL 823 863 PS50034 NULL

NULL 864 904 PS50034 NULL

NULL 905 944 PS50034 NULL

NULL 945 987 PS50034 NULL

NULL 1072 1114 PS50034 NULL

NULL 1115 1155 PS50034 NULL

NULL 1161 1201 PS50034 NULL

NULL 1333 1377 PS50034 NULL

ScanRegExp IPR006209 208 219 PS00022 EGF-like domain

IPR001881 434 458 PS01187 EGF-like calcium-binding

IPR000152 449 460 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 678 693 PS01186 EGF-like domain

IPR001881 695 720 PS01187 EGF-like calcium-binding

IPR000152 711 722 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 739 764 PS01187 EGF-like calcium-binding

IPR000152 755 766 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 782 806 PS01187 EGF-like calcium-binding

IPR001881 823 847 PS01187 EGF-like calcium-binding

IPR000152 838 849 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 847 862 PS01186 EGF-like domain

IPR001881 864 888 PS01187 EGF-like calcium-binding

IPR000152 879 890 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 888 903 PS01186 EGF-like domain

IPR001881 905 929 PS01187 EGF-like calcium-binding

IPR000152 920 931 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 945 971 PS01187 EGF-like calcium-binding

IPR000152 962 973 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 971 986 PS01186 EGF-like domain

IPR001881 1072 1098 PS01187 EGF-like calcium-binding

IPR000152 1089 1100 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 1098 1113 PS01186 EGF-like domain

IPR001881 1115 1139 PS01187 EGF-like calcium-binding

IPR000152 1130 1141 PS00010 Aspartic acid and asparagine hydroxylation site

IPR001881 1161 1185 PS01187 EGF-like calcium-binding

IPR000152 1176 1187 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 1185 1200 PS01186 EGF-like domain

IPR006209 1316 1331 PS01186 EGF-like domain

IPR001881 1333 1361 PS01187 EGF-like calcium-binding

IPR000152 1352 1363 PS00010 Aspartic acid and asparagine hydroxylation site

IPR006209 1361 1376 PS01186 EGF-like domain

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001438	695	706	PR00010	Type II EGF-like signature
IPR001438	818	825	PR00010	Type II EGF-like signature
IPR001438	967	977	PR00010	Type II EGF-like signature
HMMPfam	IPR006209	192	219	PF00008	EGF-like domain
IPR002212	366	409	PF00683	Matrix fibril-associated
NULL	434	473	PF07645	NULL
IPR002212	492	533	PF00683	Matrix fibril-associated
NULL	695	737	PF07645	NULL
NULL	739	771	PF07645	NULL
NULL	782	821	PF07645	NULL
NULL	823	862	PF07645	NULL
NULL	864	903	PF07645	NULL
IPR006209	868	903	PF00008	EGF-like domain
NULL	905	943	PF07645	NULL
NULL	945	986	PF07645	NULL
IPR006209	949	986	PF00008	EGF-like domain
IPR002212	1006	1049	PF00683	Matrix fibril-associated
NULL	1072	1113	PF07645	NULL
NULL	1115	1154	PF07645	NULL
IPR006209	1119	1154	PF00008	EGF-like domain
NULL	1161	1200	PF07645	NULL
IPR002212	1225	1270	PF00683	Matrix fibril-associated
NULL	1333	1376	PF07645	NULL
HMMSmart	IPR006210	191	220	SM00181	Type I EGF
IPR001881	192	220	SM00179	EGF-like calcium-binding
IPR001881	434	474	SM00179	EGF-like calcium-binding
IPR006210	437	474	SM00181	Type I EGF
IPR001881	653	694	SM00179	EGF-like calcium-binding
IPR006210	656	694	SM00181	Type I EGF
IPR001881	695	738	SM00179	EGF-like calcium-binding
IPR006210	698	738	SM00181	Type I EGF
IPR001881	739	781	SM00179	EGF-like calcium-binding
IPR006210	742	781	SM00181	Type I EGF
IPR001881	782	822	SM00179	EGF-like calcium-binding
IPR006210	785	822	SM00181	Type I EGF
IPR001881	823	863	SM00179	EGF-like calcium-binding
IPR006210	826	863	SM00181	Type I EGF
IPR001881	864	904	SM00179	EGF-like calcium-binding
IPR006210	867	904	SM00181	Type I EGF
IPR001881	905	944	SM00179	EGF-like calcium-binding
IPR006210	908	944	SM00181	Type I EGF
IPR001881	945	987	SM00179	EGF-like calcium-binding
IPR006210	948	987	SM00181	Type I EGF
IPR001881	1072	1114	SM00179	EGF-like calcium-binding
IPR006210	1075	1114	SM00181	Type I EGF
IPR001881	1115	1155	SM00179	EGF-like calcium-binding
IPR006210	1118	1155	SM00181	Type I EGF
IPR001881	1161	1201	SM00179	EGF-like calcium-binding
IPR006210	1164	1201	SM00181	Type I EGF
IPR001881	1296	1332	SM00179	EGF-like calcium-binding
IPR006210	1299	1332	SM00181	Type I EGF
IPR001881	1333	1377	SM00179	EGF-like calcium-binding
IPR006210	1336	1377	SM00181	Type I EGF
ProfileScan	IPR000694	25	84	PS50099	Proline-rich region
NULL	83	246	PS50315	NULL
NULL	434	474	PS50034	NULL
NULL	653	694	PS50034	NULL
NULL	657	973	PS50311	NULL
NULL	695	738	PS50034	NULL
NULL	739	781	PS50034	NULL
NULL	782	822	PS50034	NULL
NULL	823	863	PS50034	NULL
NULL	864	904	PS50034	NULL
NULL	905	944	PS50034	NULL
NULL	945	987	PS50034	NULL
NULL	1072	1114	PS50034	NULL
NULL	1115	1155	PS50034	NULL
NULL	1161	1201	PS50034	NULL
NULL	1333	1377	PS50034	NULL
ScanRegExp	IPR006209	208	219	PS00022	EGF-like domain
IPR001881	434	458	PS01187	EGF-like calcium-binding
IPR000152	449	460	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	678	693	PS01186	EGF-like domain
IPR001881	695	720	PS01187	EGF-like calcium-binding
IPR000152	711	722	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	739	764	PS01187	EGF-like calcium-binding
IPR000152	755	766	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	782	806	PS01187	EGF-like calcium-binding
IPR001881	823	847	PS01187	EGF-like calcium-binding
IPR000152	838	849	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	847	862	PS01186	EGF-like domain
IPR001881	864	888	PS01187	EGF-like calcium-binding
IPR000152	879	890	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	888	903	PS01186	EGF-like domain
IPR001881	905	929	PS01187	EGF-like calcium-binding
IPR000152	920	931	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	945	971	PS01187	EGF-like calcium-binding
IPR000152	962	973	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	971	986	PS01186	EGF-like domain
IPR001881	1072	1098	PS01187	EGF-like calcium-binding
IPR000152	1089	1100	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	1098	1113	PS01186	EGF-like domain
IPR001881	1115	1139	PS01187	EGF-like calcium-binding
IPR000152	1130	1141	PS00010	Aspartic acid and asparagine hydroxylation site
IPR001881	1161	1185	PS01187	EGF-like calcium-binding
IPR000152	1176	1187	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	1185	1200	PS01186	EGF-like domain
IPR006209	1316	1331	PS01186	EGF-like domain
IPR001881	1333	1361	PS01187	EGF-like calcium-binding
IPR000152	1352	1363	PS00010	Aspartic acid and asparagine hydroxylation site
IPR006209	1361	1376	PS01186	EGF-like domain

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 98 120 AGAAGLLALLLLLLLLLGLGGRV

Method	From	To	amino acid sequence
SOSUI	98	120	AGAAGLLALLLLLLLLLGLGGRV

Expression profile

RT-PCR-ELISA	Description

Experimental conditions

Primer_f	: AGAGCAAGTGCCACAAGTGTC
Primer_r	: ATAGGAGCCAGGGTTGTTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	261 bp
Genome contig ID	gi29824582r_65456434
PolyA signal sequence (GATAAA,-23)	+--------+--------+----*----+---- TTCCTAGAAACTGATAAATCAGATCGTGCCTCTTT
Flanking genome sequence	None