Gene/Protein Characteristic Table for FLJ00036 |
Description |
Product ID: | ORK04009 |
---|---|
Accession No.: | AK024446 |
Alias Name: | |
Clone Name: | as00036 [Vector Info] |
Source: | Human spleen |
Features of the cloned DNA sequence | Description |
---|
Length: 4538
cloned DNA seq.
| |
Length of 3'UTR 331 bp Genome contig ID gi29824577f_43304951 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
TTACATTCTGTGTATTAAAAAAATAATATTTCTGGFlanking genome sequence
(114626 - 114675) ----+----*----+----*----+----*----+----*----+----*
TGTGAGGCTGAGGTCTCCTCTGTGTGTGTACCCAAGCTGAAGGGTGGTGA
Features of the predicted protein sequence | Description |
---|
Length: 706
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA | Description |
---|