Gene/Protein Characteristic Table for FLJ00036 |
Description |
| Product ID: | ORK04009 |
|---|---|
| Accession No.: | AK024446 |
| Alias Name: | |
| Clone Name: | as00036 [Vector Info] |
| Source: | Human spleen |
| Features of the cloned DNA sequence | Description |
|---|
Length: 4538
|
cloned DNA seq.
| |
Length of 3'UTR 331 bp Genome contig ID gi29824577f_43304951 PolyA signal sequence
(ATTAAA,-22)
TTACATTCTGTGTATTAAAAAAATAATATTTCTGGFlanking genome sequence
(114626 - 114675)
TGTGAGGCTGAGGTCTCCTCTGTGTGTGTACCCAAGCTGAAGGGTGGTGA
| Features of the predicted protein sequence | Description |
|---|
Length: 706
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| RT-PCR-ELISA | Description |
|---|
