Gene/Protein Characteristic Table for FLJ00017 |
Description |
| Product ID: | ORK06504 |
|---|---|
| Accession No.: | AK024428 |
| Alias Name: | |
| Clone Name: | as00017 [Vector Info] |
| Source: | Human spleen |
| Features of the cloned DNA sequence | Description |
|---|
Length: 4459
|
cloned DNA seq.
| |
| Features of the predicted protein sequence | Description |
|---|
Length: 291
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| RT-PCR-ELISA | Description |
|---|
| : AGAAGCTGAAGGATGAGATTG | |
| : TGAAATACTGGATACCCTTGG | |
| : 95 °C |