Gene/Protein Characteristic Table for FLJ00017

Description

Product ID:	ORK06504
Accession No.:	AK024428
Alias Name:
Clone Name:	as00017 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4459
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Features of the predicted protein sequence	Description

Length: 291

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15718	1.2e-129	100.0	FLJ00017 protei...	Homo sapiens
EAW60154	3.4e-123	100.0	pleckstrin homo...	Homo sapiens
Q9UIA0	7.2e-100	100.0	Cytohesin-4; PH...	Homo sapiens
BAG37529	7.2e-100	100.0	unnamed protein...	Homo sapiens
XP_001086587	2.6e-99	98.7	pleckstrin homo...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018306	9.7e-24	37.0	KIAA0763
AB011094	1.7e-22	38.0	KIAA0522
AB029033	4.7e-22	39.6	KIAA1110
D87435	7.7e-21	38.4	KIAA0248
AB095931	1.1e-12	29.6	KIAA2011

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000904 70 265 PF01369 SEC7-like domain

HMMSmart IPR000904 71 265 SM00222 SEC7-like domain

ProfileScan IPR000904 67 254 PS50190 SEC7-like domain

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	70	265	PF01369	SEC7-like domain
HMMSmart	IPR000904	71	265	SM00222	SEC7-like domain
ProfileScan	IPR000904	67	254	PS50190	SEC7-like domain

Method	From	To	amino acid sequence
-	-	-	-

Expression profile

RT-PCR-ELISA	Description

Experimental conditions

Primer_f	: AGAAGCTGAAGGATGAGATTG
Primer_r	: TGAAATACTGGATACCCTTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES