ROUGE

Gene/Protein Characteristic Table for mKIAA0993

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093277
Description :	WD repeat and FYVE domain containing 3. galactosyltransferase 3 beta 1, 4.
Clone Name :	mbg00079 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5141 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3200 bp

Genome contig ID gi65498774r_100754515
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTTCATTTCAAATAAATACCTACTATTTACCCC
Flanking genome sequence
(99998 - 99949)
----+----*----+----*----+----*----+----*----+----*
AAAATAATTTTAAGTTGTTTTTAAATTTAAGTTCTTTAGAAAAGAAAACC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0993 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0993	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1941
Length: 646 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL20258	100.0	mCG126751 [Mus ...	Mus musculus
Q6VNB8	100.0	WD repeat and F...	Mus musculus
EDL99536	97.2	rCG37816 [Rattu...	Rattus norvegicus
XP_001060345	97.2	similar to WD r...	Rattus norvegicus
XP_001060403	97.2	similar to WD r...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173214	1.2e-35	46.3	mKIAA1607
AK129158	1.5e-16	33.2	mKIAA0540
Y18276	4.6e-14	34.4	mKIAA1544
AF262986	4.3e-06	29.1	mKIAA0647
AK129414	5.1e-06	22.1	mKIAA1643

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001680 213 227 PR00320 WD-40 repeat

IPR001680 262 276 PR00320 WD-40 repeat

IPR001680 352 366 PR00320 WD-40 repeat

HMMPfam IPR000409 1 96 PF02138 Beige/BEACH

IPR001680 238 275 PF00400 WD-40 repeat

IPR001680 280 316 PF00400 WD-40 repeat

IPR001680 323 365 PF00400 WD-40 repeat

IPR000306 569 635 PF01363 Zinc finger

HMMSmart IPR001680 192 226 SM00320 WD-40 repeat

IPR001680 236 275 SM00320 WD-40 repeat

IPR001680 278 316 SM00320 WD-40 repeat

IPR001680 321 365 SM00320 WD-40 repeat

IPR001680 519 558 SM00320 WD-40 repeat

IPR000306 566 635 SM00064 Zinc finger

ProfileScan IPR000409 1 96 PS50197 Beige/BEACH

IPR001680 208 374 PS50294 WD-40 repeat

IPR001680 243 284 PS50082 WD-40 repeat

IPR000306 574 634 PS50178 Zinc finger

ScanRegExp IPR001680 262 276 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	213	227	PR00320	WD-40 repeat
IPR001680	262	276	PR00320	WD-40 repeat
IPR001680	352	366	PR00320	WD-40 repeat
HMMPfam	IPR000409	1	96	PF02138	Beige/BEACH
IPR001680	238	275	PF00400	WD-40 repeat
IPR001680	280	316	PF00400	WD-40 repeat
IPR001680	323	365	PF00400	WD-40 repeat
IPR000306	569	635	PF01363	Zinc finger
HMMSmart	IPR001680	192	226	SM00320	WD-40 repeat
IPR001680	236	275	SM00320	WD-40 repeat
IPR001680	278	316	SM00320	WD-40 repeat
IPR001680	321	365	SM00320	WD-40 repeat
IPR001680	519	558	SM00320	WD-40 repeat
IPR000306	566	635	SM00064	Zinc finger
ProfileScan	IPR000409	1	96	PS50197	Beige/BEACH
IPR001680	208	374	PS50294	WD-40 repeat
IPR001680	243	284	PS50082	WD-40 repeat
IPR000306	574	634	PS50178	Zinc finger
ScanRegExp	IPR001680	262	276	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3200 bp
Genome contig ID	gi65498774r_100754515
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTTCATTTCAAATAAATACCTACTATTTACCCC
Flanking genome sequence (99998 - 99949)	----+--------+--------+--------+--------+----* AAAATAATTTTAAGTTGTTTTTAAATTTAAGTTCTTTAGAAAAGAAAACC

Gene/Protein Characteristic Table for mKIAA0993

Features of the cloned DNA sequence

Features of the protein sequence