ROUGE

Gene/Protein Characteristic Table for mKIAA0546

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172969
Description :
Clone Name :	mbg01323 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5656 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 738 bp

Genome contig ID gi65524842f_114987782
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTTAATTTATAATAAAGTTTAACAGTTTAAAGAAC
Flanking genome sequence
(131781 - 131830)
----+----*----+----*----+----*----+----*----+----*
AGTTAATAGTGGGACTGTTTTGTGTTCACTACTTTGAAGTATTAAGTGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0546 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0546	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4918
Length: 1638 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI39125	100.0	Zinc finger, C3...	Mus musculus
XP_001078700	96.7	hypothetical pr...	Rattus norvegicus
O60293	92.4	Zinc finger C3H...	Homo sapiens
XP_509222	92.2	proline/serine-...	Pan troglodytes
XP_001495505	92.2	coiled-coil dom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 1285 1318 PF07719 NULL

HMMSmart IPR003107 1030 1062 SM00386 RNA-processing protein

IPR003107 1064 1095 SM00386 RNA-processing protein

IPR003107 1299 1331 SM00386 RNA-processing protein

IPR003107 1408 1443 SM00386 RNA-processing protein

IPR003107 1568 1600 SM00386 RNA-processing protein

ProfileScan IPR000694 191 265 PS50099 Proline-rich region

IPR001440 1010 1083 PS50293 TPR repeat

IPR001440 1251 1318 PS50293 TPR repeat

IPR001440 1285 1318 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	1285	1318	PF07719	NULL
HMMSmart	IPR003107	1030	1062	SM00386	RNA-processing protein
IPR003107	1064	1095	SM00386	RNA-processing protein
IPR003107	1299	1331	SM00386	RNA-processing protein
IPR003107	1408	1443	SM00386	RNA-processing protein
IPR003107	1568	1600	SM00386	RNA-processing protein
ProfileScan	IPR000694	191	265	PS50099	Proline-rich region
IPR001440	1010	1083	PS50293	TPR repeat
IPR001440	1251	1318	PS50293	TPR repeat
IPR001440	1285	1318	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	738 bp
Genome contig ID	gi65524842f_114987782
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTTAATTTATAATAAAGTTTAACAGTTTAAAGAAC
Flanking genome sequence (131781 - 131830)	----+--------+--------+--------+--------+----* AGTTAATAGTGGGACTGTTTTGTGTTCACTACTTTGAAGTATTAAGTGGT

Gene/Protein Characteristic Table for mKIAA0546

Features of the cloned DNA sequence

Features of the protein sequence